Incidental Mutation 'R6680:Ankrd31'
ID527464
Institutional Source Beutler Lab
Gene Symbol Ankrd31
Ensembl Gene ENSMUSG00000109561
Gene Nameankyrin repeat domain 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96748272-96910039 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 96830609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146720 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000207464
Predicted Effect probably null
Transcript: ENSMUST00000208758
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
AW011738 A G 4: 156,203,725 probably benign Het
Ccl3 A G 11: 83,648,306 S76P probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Sox6 C T 7: 115,476,983 E765K possibly damaging Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Ugt3a2 T C 15: 9,370,068 Y433H probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Wdr92 T C 11: 17,229,857 L286P probably damaging Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Zscan4d A T 7: 11,162,439 S335T possibly damaging Het
Other mutations in Ankrd31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6001:Ankrd31 UTSW 13 96826209 missense probably damaging 1.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6273:Ankrd31 UTSW 13 96851673 missense possibly damaging 0.61
R6291:Ankrd31 UTSW 13 96878238 missense possibly damaging 0.72
R6387:Ankrd31 UTSW 13 96830573 missense probably damaging 0.99
R6608:Ankrd31 UTSW 13 96832780 missense probably damaging 0.99
R6738:Ankrd31 UTSW 13 96904127 missense possibly damaging 0.79
R6860:Ankrd31 UTSW 13 96831586 missense probably benign 0.01
R6988:Ankrd31 UTSW 13 96878249 missense probably damaging 1.00
R7305:Ankrd31 UTSW 13 96878971 missense probably damaging 0.99
R7586:Ankrd31 UTSW 13 96832054 missense possibly damaging 0.92
R7631:Ankrd31 UTSW 13 96878954 missense probably benign 0.04
R7842:Ankrd31 UTSW 13 96821458 critical splice donor site probably null
R7890:Ankrd31 UTSW 13 96831871 missense probably benign 0.27
R7911:Ankrd31 UTSW 13 96879100 missense possibly damaging 0.47
R8052:Ankrd31 UTSW 13 96832528 missense probably benign 0.07
R8133:Ankrd31 UTSW 13 96866495 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTCCCCGAAGCTTATAATG -3'
(R):5'- CACTAAGAGGCTGGAACCTTC -3'

Sequencing Primer
(F):5'- TGAGTACAAACCTGCTGGC -3'
(R):5'- AAGAGGCTGGAACCTTCTGCTATC -3'
Posted On2018-07-23