Incidental Mutation 'R6680:Ugt3a2'
ID527466
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9370068 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 433 (Y433H)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably damaging
Transcript: ENSMUST00000072403
AA Change: Y433H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: Y433H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Meta Mutation Damage Score 0.7663 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
Ankrd31 T A 13: 96,830,609 probably null Het
AW011738 A G 4: 156,203,725 probably benign Het
Ccl3 A G 11: 83,648,306 S76P probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Sox6 C T 7: 115,476,983 E765K possibly damaging Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Wdr92 T C 11: 17,229,857 L286P probably damaging Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Zscan4d A T 7: 11,162,439 S335T possibly damaging Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R8229:Ugt3a2 UTSW 15 9367377 missense probably damaging 0.99
R8296:Ugt3a2 UTSW 15 9361938 missense probably benign 0.18
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGTAAGGGTTTGCCAACAG -3'
(R):5'- GAAGACATCAAGCATGTACTGC -3'

Sequencing Primer
(F):5'- AAGGGTTTGCCAACAGATTTG -3'
(R):5'- ATGTACTGCTCATGCCATGG -3'
Posted On2018-07-23