Incidental Mutation 'R6681:Dnah7a'
ID 527475
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7, LOC381341, Dnahc7a
MMRRC Submission 044800-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R6681 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53436165-53745943 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 53560385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000094964
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 121,915,447 (GRCm39) T971S probably damaging Het
Catsperb C T 12: 101,590,994 (GRCm39) Q1021* probably null Het
Ccdc62 A G 5: 124,072,156 (GRCm39) T62A probably benign Het
Cuzd1 A G 7: 130,913,412 (GRCm39) S402P probably damaging Het
Dcun1d1 C T 3: 35,949,819 (GRCm39) V244M probably damaging Het
Dennd2c A G 3: 103,038,977 (GRCm39) T42A probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dpp4 A T 2: 62,178,893 (GRCm39) F607L probably benign Het
Ech1 C T 7: 28,529,763 (GRCm39) probably null Het
Fam53a A G 5: 33,765,184 (GRCm39) L174P probably damaging Het
Fh1 T C 1: 175,446,690 (GRCm39) D62G probably null Het
Gpatch11 T C 17: 79,147,528 (GRCm39) I103T probably damaging Het
Hmgcll1 A T 9: 75,988,731 (GRCm39) T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 (GRCm39) I354F probably benign Het
Kdm5b T C 1: 134,541,007 (GRCm39) F700L possibly damaging Het
Mamdc4 C A 2: 25,457,756 (GRCm39) G439V probably damaging Het
Mrps30 A T 13: 118,517,134 (GRCm39) S362T probably damaging Het
Mug1 C T 6: 121,815,683 (GRCm39) S29L possibly damaging Het
Myh2 G A 11: 67,069,174 (GRCm39) D328N probably damaging Het
Or10j3b C A 1: 173,043,973 (GRCm39) H252N probably damaging Het
Or5b98 A G 19: 12,931,823 (GRCm39) Y290C probably damaging Het
Or5j1 T C 2: 86,878,942 (GRCm39) T213A probably benign Het
Or8g54 T A 9: 39,706,710 (GRCm39) I13N probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pira13 T A 7: 3,825,251 (GRCm39) M464L probably benign Het
Pus7l G A 15: 94,425,746 (GRCm39) P552S probably benign Het
Rest A G 5: 77,428,844 (GRCm39) K421R probably damaging Het
Rttn C A 18: 89,032,735 (GRCm39) H668N probably damaging Het
Scn9a T C 2: 66,393,686 (GRCm39) I228V possibly damaging Het
Scp2 G T 4: 107,948,513 (GRCm39) Q155K probably damaging Het
Sec61a2 G A 2: 5,881,219 (GRCm39) R18* probably null Het
Serpinb8 T A 1: 107,525,321 (GRCm39) M41K probably damaging Het
Sgsm2 A T 11: 74,756,204 (GRCm39) W382R probably damaging Het
Slc26a10 G T 10: 127,009,530 (GRCm39) T606N possibly damaging Het
Slc30a6 T C 17: 74,711,027 (GRCm39) I40T possibly damaging Het
Slfn5 G A 11: 82,847,204 (GRCm39) E30K possibly damaging Het
Sorcs2 C A 5: 36,555,154 (GRCm39) R79L probably benign Het
Tmc5 G A 7: 118,268,527 (GRCm39) S865N probably damaging Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Trpv5 C G 6: 41,630,288 (GRCm39) E601Q probably damaging Het
Ttc39b A T 4: 83,158,285 (GRCm39) probably benign Het
Ttll6 T A 11: 96,029,689 (GRCm39) C201S probably damaging Het
Vezt A G 10: 93,832,859 (GRCm39) V204A probably benign Het
Vmn1r45 T A 6: 89,910,985 (GRCm39) probably benign Het
Zfp433 A T 10: 81,556,722 (GRCm39) H408L probably damaging Het
Zfp865 T C 7: 5,032,450 (GRCm39) I145T possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,458,843 (GRCm39) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,540,701 (GRCm39) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,496,905 (GRCm39) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,701,540 (GRCm39) missense probably benign
IGL01417:Dnah7a APN 1 53,623,759 (GRCm39) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,666,231 (GRCm39) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,458,754 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,557,941 (GRCm39) missense probably benign
IGL01575:Dnah7a APN 1 53,466,979 (GRCm39) splice site probably benign
IGL01667:Dnah7a APN 1 53,586,451 (GRCm39) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,462,429 (GRCm39) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,543,429 (GRCm39) missense probably benign
IGL01829:Dnah7a APN 1 53,657,227 (GRCm39) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,623,608 (GRCm39) splice site probably benign
IGL01861:Dnah7a APN 1 53,679,508 (GRCm39) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,741,174 (GRCm39) splice site probably null
IGL02056:Dnah7a APN 1 53,543,501 (GRCm39) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,601,053 (GRCm39) splice site probably benign
IGL02072:Dnah7a APN 1 53,644,986 (GRCm39) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,450,739 (GRCm39) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,534,876 (GRCm39) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,476,672 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,662,632 (GRCm39) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,512,023 (GRCm39) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,458,882 (GRCm39) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,512,052 (GRCm39) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,682,669 (GRCm39) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,564,096 (GRCm39) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,674,556 (GRCm39) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,725,702 (GRCm39) missense probably benign
IGL02458:Dnah7a APN 1 53,657,487 (GRCm39) nonsense probably null
IGL02489:Dnah7a APN 1 53,686,481 (GRCm39) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,657,205 (GRCm39) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,472,074 (GRCm39) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,564,194 (GRCm39) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,543,183 (GRCm39) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,483,631 (GRCm39) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,512,118 (GRCm39) splice site probably benign
IGL02874:Dnah7a APN 1 53,644,973 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,561,519 (GRCm39) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,616,487 (GRCm39) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,535,109 (GRCm39) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,472,163 (GRCm39) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,644,983 (GRCm39) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,458,766 (GRCm39) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,725,773 (GRCm39) splice site probably benign
IGL03214:Dnah7a APN 1 53,561,368 (GRCm39) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,659,882 (GRCm39) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,686,433 (GRCm39) missense probably benign
IGL03265:Dnah7a APN 1 53,568,007 (GRCm39) missense probably benign
IGL03277:Dnah7a APN 1 53,669,481 (GRCm39) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,536,124 (GRCm39) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,543,093 (GRCm39) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,570,362 (GRCm39) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,496,033 (GRCm39) splice site probably null
R0051:Dnah7a UTSW 1 53,560,245 (GRCm39) splice site probably benign
R0082:Dnah7a UTSW 1 53,557,867 (GRCm39) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,507,843 (GRCm39) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,436,301 (GRCm39) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,540,685 (GRCm39) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,543,305 (GRCm39) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,444,849 (GRCm39) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,472,213 (GRCm39) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,543,357 (GRCm39) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,644,978 (GRCm39) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,536,285 (GRCm39) missense probably benign
R0576:Dnah7a UTSW 1 53,675,246 (GRCm39) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,495,771 (GRCm39) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,536,264 (GRCm39) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,659,840 (GRCm39) nonsense probably null
R0735:Dnah7a UTSW 1 53,583,670 (GRCm39) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,604,855 (GRCm39) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,543,238 (GRCm39) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,540,833 (GRCm39) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,467,019 (GRCm39) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,507,828 (GRCm39) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,686,395 (GRCm39) splice site probably benign
R1421:Dnah7a UTSW 1 53,580,032 (GRCm39) splice site probably benign
R1445:Dnah7a UTSW 1 53,567,956 (GRCm39) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,535,173 (GRCm39) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,535,148 (GRCm39) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,495,843 (GRCm39) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,601,059 (GRCm39) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,543,344 (GRCm39) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,472,046 (GRCm39) splice site probably null
R1779:Dnah7a UTSW 1 53,616,382 (GRCm39) missense probably benign
R1816:Dnah7a UTSW 1 53,670,901 (GRCm39) splice site probably benign
R1817:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1818:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1819:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1873:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1875:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1884:Dnah7a UTSW 1 53,580,159 (GRCm39) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,670,721 (GRCm39) missense probably benign
R1959:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,543,093 (GRCm39) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,621,835 (GRCm39) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,621,741 (GRCm39) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,496,855 (GRCm39) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,542,968 (GRCm39) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,536,101 (GRCm39) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,645,034 (GRCm39) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,518,932 (GRCm39) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,560,333 (GRCm39) missense probably benign
R2355:Dnah7a UTSW 1 53,621,661 (GRCm39) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,645,040 (GRCm39) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,467,031 (GRCm39) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,466,983 (GRCm39) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,542,713 (GRCm39) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,657,275 (GRCm39) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,483,675 (GRCm39) missense probably benign
R3723:Dnah7a UTSW 1 53,486,505 (GRCm39) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,540,815 (GRCm39) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,670,840 (GRCm39) missense probably benign
R4009:Dnah7a UTSW 1 53,564,164 (GRCm39) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,464,376 (GRCm39) missense probably benign
R4193:Dnah7a UTSW 1 53,486,493 (GRCm39) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,486,524 (GRCm39) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,483,685 (GRCm39) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,488,197 (GRCm39) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,450,818 (GRCm39) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,495,816 (GRCm39) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,467,110 (GRCm39) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,486,476 (GRCm39) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,464,367 (GRCm39) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,745,888 (GRCm39) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,542,737 (GRCm39) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5000:Dnah7a UTSW 1 53,606,201 (GRCm39) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,686,407 (GRCm39) nonsense probably null
R5026:Dnah7a UTSW 1 53,701,657 (GRCm39) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,536,255 (GRCm39) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5151:Dnah7a UTSW 1 53,659,929 (GRCm39) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,682,654 (GRCm39) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,462,446 (GRCm39) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,476,768 (GRCm39) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,486,690 (GRCm39) splice site probably null
R5267:Dnah7a UTSW 1 53,518,851 (GRCm39) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,542,805 (GRCm39) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,586,331 (GRCm39) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,670,812 (GRCm39) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,674,503 (GRCm39) missense probably benign
R5496:Dnah7a UTSW 1 53,496,927 (GRCm39) missense probably benign
R5531:Dnah7a UTSW 1 53,458,907 (GRCm39) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,464,412 (GRCm39) missense probably benign
R5543:Dnah7a UTSW 1 53,543,228 (GRCm39) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,573,611 (GRCm39) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,621,753 (GRCm39) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,444,866 (GRCm39) missense probably benign
R5644:Dnah7a UTSW 1 53,580,138 (GRCm39) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,444,857 (GRCm39) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,452,937 (GRCm39) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,522,478 (GRCm39) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,496,944 (GRCm39) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,598,467 (GRCm39) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,659,829 (GRCm39) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,496,004 (GRCm39) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,458,814 (GRCm39) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,450,727 (GRCm39) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,472,181 (GRCm39) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,458,795 (GRCm39) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,542,760 (GRCm39) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,580,273 (GRCm39) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,436,349 (GRCm39) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,542,856 (GRCm39) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,495,693 (GRCm39) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,564,277 (GRCm39) missense probably benign
R6625:Dnah7a UTSW 1 53,604,916 (GRCm39) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,662,609 (GRCm39) missense probably benign 0.00
R6747:Dnah7a UTSW 1 53,675,221 (GRCm39) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,737,810 (GRCm39) missense probably benign
R6823:Dnah7a UTSW 1 53,495,863 (GRCm39) missense probably benign
R6900:Dnah7a UTSW 1 53,701,510 (GRCm39) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,670,836 (GRCm39) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,616,446 (GRCm39) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,701,526 (GRCm39) missense probably null
R6988:Dnah7a UTSW 1 53,621,784 (GRCm39) missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53,543,448 (GRCm39) missense probably benign
R7027:Dnah7a UTSW 1 53,670,665 (GRCm39) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,518,820 (GRCm39) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,458,912 (GRCm39) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,522,599 (GRCm39) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,452,927 (GRCm39) nonsense probably null
R7144:Dnah7a UTSW 1 53,737,867 (GRCm39) splice site probably null
R7167:Dnah7a UTSW 1 53,542,935 (GRCm39) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,659,620 (GRCm39) splice site probably null
R7196:Dnah7a UTSW 1 53,724,000 (GRCm39) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,737,792 (GRCm39) nonsense probably null
R7215:Dnah7a UTSW 1 53,657,509 (GRCm39) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,436,420 (GRCm39) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,557,973 (GRCm39) missense probably benign
R7282:Dnah7a UTSW 1 53,724,059 (GRCm39) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,536,297 (GRCm39) missense probably benign
R7392:Dnah7a UTSW 1 53,540,820 (GRCm39) missense probably benign 0.00
R7454:Dnah7a UTSW 1 53,557,923 (GRCm39) missense probably benign
R7471:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,702,996 (GRCm39) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,567,857 (GRCm39) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,586,456 (GRCm39) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,670,842 (GRCm39) missense probably benign
R7813:Dnah7a UTSW 1 53,657,245 (GRCm39) missense probably benign
R7839:Dnah7a UTSW 1 53,606,334 (GRCm39) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,682,621 (GRCm39) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,543,377 (GRCm39) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,543,049 (GRCm39) missense probably benign
R8140:Dnah7a UTSW 1 53,540,748 (GRCm39) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,666,194 (GRCm39) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,724,178 (GRCm39) missense probably benign
R8352:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,512,063 (GRCm39) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,512,112 (GRCm39) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,657,195 (GRCm39) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,657,142 (GRCm39) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,512,067 (GRCm39) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,657,139 (GRCm39) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,679,520 (GRCm39) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,472,175 (GRCm39) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,535,088 (GRCm39) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,674,476 (GRCm39) missense probably benign
R8856:Dnah7a UTSW 1 53,462,422 (GRCm39) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,682,682 (GRCm39) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,682,594 (GRCm39) splice site probably benign
R8982:Dnah7a UTSW 1 53,570,301 (GRCm39) missense probably benign
R8984:Dnah7a UTSW 1 53,674,436 (GRCm39) nonsense probably null
R8993:Dnah7a UTSW 1 53,543,262 (GRCm39) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,701,501 (GRCm39) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,512,116 (GRCm39) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,560,297 (GRCm39) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,741,218 (GRCm39) missense unknown
R9167:Dnah7a UTSW 1 53,657,370 (GRCm39) missense probably benign 0.00
R9206:Dnah7a UTSW 1 53,540,757 (GRCm39) missense probably benign 0.11
R9226:Dnah7a UTSW 1 53,560,326 (GRCm39) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,621,671 (GRCm39) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,674,505 (GRCm39) missense probably benign
R9350:Dnah7a UTSW 1 53,436,307 (GRCm39) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,564,222 (GRCm39) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,543,421 (GRCm39) missense probably benign
R9372:Dnah7a UTSW 1 53,543,474 (GRCm39) missense probably benign
R9376:Dnah7a UTSW 1 53,568,058 (GRCm39) critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53,621,776 (GRCm39) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,568,026 (GRCm39) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,450,812 (GRCm39) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,561,495 (GRCm39) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
R9712:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R9799:Dnah7a UTSW 1 53,557,968 (GRCm39) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,512,089 (GRCm39) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,507,802 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,522,622 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,598,261 (GRCm39) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,450,815 (GRCm39) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,682,616 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGAGTGACGTCAGTTGTTACC -3'
(R):5'- CATCTTGAGTGGAAATAAGTTGTGG -3'

Sequencing Primer
(F):5'- CTAGGGATGCTTTCATAGGAACATG -3'
(R):5'- GGTATTAGTGTCTCCCCAAACAGG -3'
Posted On 2018-07-23