Incidental Mutation 'R6681:Olfr1404'
ID527478
Institutional Source Beutler Lab
Gene Symbol Olfr1404
Ensembl Gene ENSMUSG00000049456
Gene Nameolfactory receptor 1404
SynonymsGA_x6K02T2R7CC-630397-629456, MOR267-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173212392-173218583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 173216406 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 252 (H252N)
Ref Sequence ENSEMBL: ENSMUSP00000151077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049706] [ENSMUST00000056592] [ENSMUST00000193017] [ENSMUST00000216556] [ENSMUST00000217374]
Predicted Effect probably benign
Transcript: ENSMUST00000049706
SMART Domains Protein: ENSMUSP00000056882
Gene: ENSMUSG00000005339

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 108 1.08e-8 SMART
IG 116 193 1.37e-1 SMART
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000056592
AA Change: H252N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050406
Gene: ENSMUSG00000049456
AA Change: H252N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.9e-55 PFAM
Pfam:7tm_1 42 291 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193017
SMART Domains Protein: ENSMUSP00000141932
Gene: ENSMUSG00000005339

DomainStartEndE-ValueType
IG_like 9 52 4.8e-1 SMART
IG 60 137 5.7e-4 SMART
transmembrane domain 144 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216556
AA Change: H252N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217374
AA Change: H252N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Olfr1404
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Olfr1404 APN 1 173215873 missense probably damaging 0.99
IGL01411:Olfr1404 APN 1 173216128 missense probably benign 0.01
IGL02533:Olfr1404 APN 1 173216061 missense probably damaging 0.99
IGL02559:Olfr1404 APN 1 173216521 missense probably damaging 0.98
R0233:Olfr1404 UTSW 1 173216301 missense probably benign 0.25
R0233:Olfr1404 UTSW 1 173216301 missense probably benign 0.25
R0245:Olfr1404 UTSW 1 173215957 missense possibly damaging 0.54
R0652:Olfr1404 UTSW 1 173215957 missense possibly damaging 0.54
R1613:Olfr1404 UTSW 1 173215867 missense probably benign 0.41
R1939:Olfr1404 UTSW 1 173215932 missense probably benign 0.00
R2062:Olfr1404 UTSW 1 173215710 missense probably benign 0.00
R2074:Olfr1404 UTSW 1 173215810 missense probably damaging 0.98
R6045:Olfr1404 UTSW 1 173216500 missense possibly damaging 0.94
R7192:Olfr1404 UTSW 1 173216008 missense probably damaging 0.98
R7576:Olfr1404 UTSW 1 173215971 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCTGTGATGTGAGACCCC -3'
(R):5'- CCTAATTAAGATGAAAGTGGCTTCTGC -3'

Sequencing Primer
(F):5'- TGATGTGAGACCCCTGCTGAAG -3'
(R):5'- CCACATGGCTCTGCGTAG -3'
Posted On2018-07-23