Incidental Mutation 'R6681:Sec61a2'
ID527480
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene NameSec61, alpha subunit 2 (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location5870987-5895432 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 5876408 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 18 (R18*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026926] [ENSMUST00000026927] [ENSMUST00000102981] [ENSMUST00000193792]
Predicted Effect probably benign
Transcript: ENSMUST00000026926
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026927
SMART Domains Protein: ENSMUSP00000026927
Gene: ENSMUSG00000025817

DomainStartEndE-ValueType
Pfam:NUDIX 57 191 1.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102981
AA Change: R311*
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816
AA Change: R311*

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132469
Predicted Effect probably null
Transcript: ENSMUST00000132908
AA Change: R18*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153240
Predicted Effect probably benign
Transcript: ENSMUST00000193792
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5872020 missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5886552 missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5891363 splice site probably benign
IGL02608:Sec61a2 APN 2 5874262 missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5882878 nonsense probably null
IGL03271:Sec61a2 APN 2 5882934 nonsense probably null
IGL03294:Sec61a2 APN 2 5876465 splice site probably null
R0413:Sec61a2 UTSW 2 5876354 intron probably benign
R0742:Sec61a2 UTSW 2 5876548 missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5886534 missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5873736 splice site probably benign
R2680:Sec61a2 UTSW 2 5873745 missense probably benign 0.00
R3522:Sec61a2 UTSW 2 5893216 missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5879625 splice site probably null
R4405:Sec61a2 UTSW 2 5882859 missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5873693 intron probably benign
R5387:Sec61a2 UTSW 2 5882545 intron probably benign
R5530:Sec61a2 UTSW 2 5882650 nonsense probably null
R5546:Sec61a2 UTSW 2 5876540 missense possibly damaging 0.78
R5775:Sec61a2 UTSW 2 5882774 splice site probably null
R5922:Sec61a2 UTSW 2 5874323 missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5886557 missense probably benign 0.00
R7499:Sec61a2 UTSW 2 5877914 missense probably benign 0.37
R7564:Sec61a2 UTSW 2 5882604 missense probably benign
R7947:Sec61a2 UTSW 2 5876983 missense probably damaging 0.96
R8208:Sec61a2 UTSW 2 5876998 missense probably benign 0.00
R8210:Sec61a2 UTSW 2 5876917 missense possibly damaging 0.95
R8266:Sec61a2 UTSW 2 5876839 critical splice donor site probably null
Z1177:Sec61a2 UTSW 2 5886565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTTATTGCCATTCAGG -3'
(R):5'- CGCACTCTTTGACATGGACC -3'

Sequencing Primer
(F):5'- TCAGCCTGAGTTACAGCATG -3'
(R):5'- ACTCTTTGACATGGACCACCTC -3'
Posted On2018-07-23