Mutagenetix > Incidental Mutation

Incidental Mutation 'R6681:Abca4'

527487

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

MMRRC Submission

Accession Numbers

Genbank: NM_007378; MGI: 109424

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6681 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122121798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 971 (T971S)

Ref Sequence

ENSEMBL: ENSMUSP00000013995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995]

AlphaFold

O35600

Predicted Effect

probably damaging
Transcript: ENSMUST00000013995
AA Change: T971S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: T971S

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136624

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140913

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198484

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Catsperb	C	T	12: 101,624,735	Q1021*	probably null	Het
Ccdc62	A	G	5: 123,934,093	T62A	probably benign	Het
Cuzd1	A	G	7: 131,311,683	S402P	probably damaging	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Dennd2c	A	G	3: 103,131,661	T42A	probably benign	Het
Dnah7a	T	C	1: 53,521,226		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dpp4	A	T	2: 62,348,549	F607L	probably benign	Het
Ech1	C	T	7: 28,830,338		probably null	Het
Fam53a	A	G	5: 33,607,840	L174P	probably damaging	Het
Fh1	T	C	1: 175,619,124	D62G	probably null	Het
Gm15448	T	A	7: 3,822,252	M464L	probably benign	Het
Gpatch11	T	C	17: 78,840,099	I103T	probably damaging	Het
Hmgcll1	A	T	9: 76,081,449	T169S	probably benign	Het
Kbtbd3	A	T	9: 4,330,687	I354F	probably benign	Het
Kdm5b	T	C	1: 134,613,269	F700L	possibly damaging	Het
Mamdc4	C	A	2: 25,567,744	G439V	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Mug1	C	T	6: 121,838,724	S29L	possibly damaging	Het
Myh2	G	A	11: 67,178,348	D328N	probably damaging	Het
Olfr1106	T	C	2: 87,048,598	T213A	probably benign	Het
Olfr1404	C	A	1: 173,216,406	H252N	probably damaging	Het
Olfr1450	A	G	19: 12,954,459	Y290C	probably damaging	Het
Olfr969	T	A	9: 39,795,414	I13N	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Rest	A	G	5: 77,280,997	K421R	probably damaging	Het
Rttn	C	A	18: 89,014,611	H668N	probably damaging	Het
Scn9a	T	C	2: 66,563,342	I228V	possibly damaging	Het
Scp2	G	T	4: 108,091,316	Q155K	probably damaging	Het
Sec61a2	G	A	2: 5,876,408	R18*	probably null	Het
Serpinb8	T	A	1: 107,597,591	M41K	probably damaging	Het
Sgsm2	A	T	11: 74,865,378	W382R	probably damaging	Het
Slc26a10	G	T	10: 127,173,661	T606N	possibly damaging	Het
Slc30a6	T	C	17: 74,404,032	I40T	possibly damaging	Het
Slfn5	G	A	11: 82,956,378	E30K	possibly damaging	Het
Sorcs2	C	A	5: 36,397,810	R79L	probably benign	Het
Tmc5	G	A	7: 118,669,304	S865N	probably damaging	Het
Tmprss11c	T	A	5: 86,289,260	M1L	possibly damaging	Het
Trpv5	C	G	6: 41,653,354	E601Q	probably damaging	Het
Ttc39b	A	T	4: 83,240,048		probably benign	Het
Ttll6	T	A	11: 96,138,863	C201S	probably damaging	Het
Vezt	A	G	10: 93,996,997	V204A	probably benign	Het
Vmn1r45	T	A	6: 89,934,003		probably benign	Het
Zfp433	A	T	10: 81,720,888	H408L	probably damaging	Het
Zfp865	T	C	7: 5,029,451	I145T	possibly damaging	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1763:Abca4	UTSW	3	122163830	missense	probably damaging	1.00
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4668:Abca4	UTSW	3	122155299	missense	possibly damaging	0.90
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4795:Abca4	UTSW	3	122176123	missense	probably damaging	0.99
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7758:Abca4	UTSW	3	122128167	missense	probably damaging	1.00
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
R9464:Abca4	UTSW	3	122120065	missense	probably benign	0.08
R9483:Abca4	UTSW	3	122085626	missense
R9751:Abca4	UTSW	3	122087477	missense	probably benign	0.00
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CACGGCGTCATTAACATGTGG -3'
(R):5'- TTGGTAGGAAACGGAGTGCTAC -3'

Sequencing Primer
(F):5'- ACAATGTGTTTTTCCCTCCAAGAC -3'
(R):5'- TGCTACATAAAAATAGCCCGGG -3'

Posted On

2018-07-23