Incidental Mutation 'R6681:Scp2'
ID527489
Institutional Source Beutler Lab
Gene Symbol Scp2
Ensembl Gene ENSMUSG00000028603
Gene Namesterol carrier protein 2, liver
SynonymsNSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108043839-108144998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108091316 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 155 (Q155K)
Ref Sequence ENSEMBL: ENSMUSP00000121673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000044248] [ENSMUST00000149106]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030340
AA Change: Q199K

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: Q199K

DomainStartEndE-ValueType
Pfam:Thiolase_N 14 240 9.6e-25 PFAM
Pfam:Thiolase_C 277 402 2.9e-15 PFAM
Pfam:SCP2 437 539 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143340
Predicted Effect probably damaging
Transcript: ENSMUST00000149106
AA Change: Q155K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603
AA Change: Q155K

DomainStartEndE-ValueType
SCOP:d1qfla1 14 202 2e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Scp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Scp2 APN 4 108074442 splice site probably null
IGL02190:Scp2 APN 4 108087128 missense probably benign 0.22
IGL02615:Scp2 APN 4 108107631 missense probably benign 0.40
IGL03006:Scp2 APN 4 108091280 missense probably benign 0.00
IGL03107:Scp2 APN 4 108098115 missense probably benign 0.00
IGL03124:Scp2 APN 4 108063906 missense probably damaging 1.00
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R1507:Scp2 UTSW 4 108087012 frame shift probably null
R1861:Scp2 UTSW 4 108091321 missense probably damaging 1.00
R2151:Scp2 UTSW 4 108063944 missense probably benign
R3013:Scp2 UTSW 4 108071357 missense probably damaging 1.00
R4127:Scp2 UTSW 4 108063984 missense probably benign 0.00
R4271:Scp2 UTSW 4 108085211 missense probably damaging 1.00
R4385:Scp2 UTSW 4 108071350 missense probably damaging 1.00
R5046:Scp2 UTSW 4 108071291 missense probably benign 0.07
R5345:Scp2 UTSW 4 108055579 splice site probably null
R5401:Scp2 UTSW 4 108144779 critical splice donor site probably null
R6367:Scp2 UTSW 4 108112250 missense probably damaging 1.00
R6415:Scp2 UTSW 4 108105140 missense probably benign 0.22
R6910:Scp2 UTSW 4 108105086 missense probably damaging 1.00
R6974:Scp2 UTSW 4 108071278 start codon destroyed probably null 0.01
R7206:Scp2 UTSW 4 108074441 missense probably benign 0.00
R7342:Scp2 UTSW 4 108091321 missense probably benign 0.02
R8935:Scp2 UTSW 4 108092875 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGCCAGTCTATAGAAGCTG -3'
(R):5'- AGCATGCAAGGTCACAGTTC -3'

Sequencing Primer
(F):5'- TCTATAGAAGCTGCAGAGACATC -3'
(R):5'- ACTTTGTAGACCAGGCTG -3'
Posted On2018-07-23