Mutagenetix > Incidental Mutation

Incidental Mutation 'R6681:Scp2'

527489

Institutional Source

Beutler Lab

Gene Symbol

Scp2

Ensembl Gene

ENSMUSG00000028603

Gene Name

sterol carrier protein 2, liver

Synonyms

NSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.223) question?

Stock #

R6681 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108043839-108144998 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 108091316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 155 (Q155K)

Ref Sequence

ENSEMBL: ENSMUSP00000121673 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000044248] [ENSMUST00000149106]

AlphaFold

P32020

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030340
AA Change: Q199K

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: Q199K

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	14	240	9.6e-25	PFAM
Pfam:Thiolase_C	277	402	2.9e-15	PFAM
Pfam:SCP2	437	539	1.5e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000044248

SMART Domains

Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	40	49	N/A	INTRINSIC
LRRNT	68	101	4.34e-5	SMART
LRR_TYP	120	145	2.05e-2	SMART
LRR	146	169	1.19e1	SMART
LRR	192	216	2.84e1	SMART
LRR	239	261	6.22e0	SMART
LRR	262	287	3.47e0	SMART
LRR_TYP	288	311	7.9e-4	SMART
LRR	333	358	1.26e1	SMART
LRR	359	382	2.82e0	SMART
LRR	407	429	1.53e2	SMART
LRR_TYP	430	453	7.37e-4	SMART
LRR	475	500	1.66e1	SMART
LRR	501	522	1.29e1	SMART
LRR_TYP	523	545	7.67e-2	SMART
low complexity region	594	609	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143340

Predicted Effect

probably damaging
Transcript: ENSMUST00000149106
AA Change: Q155K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603
AA Change: Q155K

Domain	Start	End	E-Value	Type
SCOP:d1qfla1	14	202	2e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183919

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	T	3: 122,121,798	T971S	probably damaging	Het
Catsperb	C	T	12: 101,624,735	Q1021*	probably null	Het
Ccdc62	A	G	5: 123,934,093	T62A	probably benign	Het
Cuzd1	A	G	7: 131,311,683	S402P	probably damaging	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Dennd2c	A	G	3: 103,131,661	T42A	probably benign	Het
Dnah7a	T	C	1: 53,521,226		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dpp4	A	T	2: 62,348,549	F607L	probably benign	Het
Ech1	C	T	7: 28,830,338		probably null	Het
Fam53a	A	G	5: 33,607,840	L174P	probably damaging	Het
Fh1	T	C	1: 175,619,124	D62G	probably null	Het
Gm15448	T	A	7: 3,822,252	M464L	probably benign	Het
Gpatch11	T	C	17: 78,840,099	I103T	probably damaging	Het
Hmgcll1	A	T	9: 76,081,449	T169S	probably benign	Het
Kbtbd3	A	T	9: 4,330,687	I354F	probably benign	Het
Kdm5b	T	C	1: 134,613,269	F700L	possibly damaging	Het
Mamdc4	C	A	2: 25,567,744	G439V	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Mug1	C	T	6: 121,838,724	S29L	possibly damaging	Het
Myh2	G	A	11: 67,178,348	D328N	probably damaging	Het
Olfr1106	T	C	2: 87,048,598	T213A	probably benign	Het
Olfr1404	C	A	1: 173,216,406	H252N	probably damaging	Het
Olfr1450	A	G	19: 12,954,459	Y290C	probably damaging	Het
Olfr969	T	A	9: 39,795,414	I13N	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Rest	A	G	5: 77,280,997	K421R	probably damaging	Het
Rttn	C	A	18: 89,014,611	H668N	probably damaging	Het
Scn9a	T	C	2: 66,563,342	I228V	possibly damaging	Het
Sec61a2	G	A	2: 5,876,408	R18*	probably null	Het
Serpinb8	T	A	1: 107,597,591	M41K	probably damaging	Het
Sgsm2	A	T	11: 74,865,378	W382R	probably damaging	Het
Slc26a10	G	T	10: 127,173,661	T606N	possibly damaging	Het
Slc30a6	T	C	17: 74,404,032	I40T	possibly damaging	Het
Slfn5	G	A	11: 82,956,378	E30K	possibly damaging	Het
Sorcs2	C	A	5: 36,397,810	R79L	probably benign	Het
Tmc5	G	A	7: 118,669,304	S865N	probably damaging	Het
Tmprss11c	T	A	5: 86,289,260	M1L	possibly damaging	Het
Trpv5	C	G	6: 41,653,354	E601Q	probably damaging	Het
Ttc39b	A	T	4: 83,240,048		probably benign	Het
Ttll6	T	A	11: 96,138,863	C201S	probably damaging	Het
Vezt	A	G	10: 93,996,997	V204A	probably benign	Het
Vmn1r45	T	A	6: 89,934,003		probably benign	Het
Zfp433	A	T	10: 81,720,888	H408L	probably damaging	Het
Zfp865	T	C	7: 5,029,451	I145T	possibly damaging	Het

Other mutations in Scp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01481:Scp2	APN	4	108074442	splice site	probably null
IGL02190:Scp2	APN	4	108087128	missense	probably benign	0.22
IGL02615:Scp2	APN	4	108107631	missense	probably benign	0.40
IGL03006:Scp2	APN	4	108091280	missense	probably benign	0.00
IGL03107:Scp2	APN	4	108098115	missense	probably benign	0.00
IGL03124:Scp2	APN	4	108063906	missense	probably damaging	1.00
R0030:Scp2	UTSW	4	108107690	critical splice acceptor site	probably null
R0030:Scp2	UTSW	4	108107690	critical splice acceptor site	probably null
R0240:Scp2	UTSW	4	108098078	missense	probably benign	0.01
R0240:Scp2	UTSW	4	108098078	missense	probably benign	0.01
R1507:Scp2	UTSW	4	108087012	frame shift	probably null
R1861:Scp2	UTSW	4	108091321	missense	probably damaging	1.00
R2151:Scp2	UTSW	4	108063944	missense	probably benign
R3013:Scp2	UTSW	4	108071357	missense	probably damaging	1.00
R4127:Scp2	UTSW	4	108063984	missense	probably benign	0.00
R4271:Scp2	UTSW	4	108085211	missense	probably damaging	1.00
R4385:Scp2	UTSW	4	108071350	missense	probably damaging	1.00
R5046:Scp2	UTSW	4	108071291	missense	probably benign	0.07
R5345:Scp2	UTSW	4	108055579	splice site	probably null
R5401:Scp2	UTSW	4	108144779	critical splice donor site	probably null
R6367:Scp2	UTSW	4	108112250	missense	probably damaging	1.00
R6415:Scp2	UTSW	4	108105140	missense	probably benign	0.22
R6910:Scp2	UTSW	4	108105086	missense	probably damaging	1.00
R6974:Scp2	UTSW	4	108071278	start codon destroyed	probably null	0.01
R7206:Scp2	UTSW	4	108074441	missense	probably benign	0.00
R7342:Scp2	UTSW	4	108091321	missense	probably benign	0.02
R8935:Scp2	UTSW	4	108092875	missense	probably damaging	0.98
R9035:Scp2	UTSW	4	108055520	missense	probably damaging	1.00
R9151:Scp2	UTSW	4	108074406	missense	possibly damaging	0.58
R9536:Scp2	UTSW	4	108071335	missense	possibly damaging	0.92
R9645:Scp2	UTSW	4	108091322	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGGCCAGTCTATAGAAGCTG -3'
(R):5'- AGCATGCAAGGTCACAGTTC -3'

Sequencing Primer
(F):5'- TCTATAGAAGCTGCAGAGACATC -3'
(R):5'- ACTTTGTAGACCAGGCTG -3'

Posted On

2018-07-23