Incidental Mutation 'R6681:Zfp865'
ID527499
Institutional Source Beutler Lab
Gene Symbol Zfp865
Ensembl Gene ENSMUSG00000116184
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5034118-5035246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5029451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 145 (I145T)
Ref Sequence ENSEMBL: ENSMUSP00000082550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062428] [ENSMUST00000076251] [ENSMUST00000076791] [ENSMUST00000085427] [ENSMUST00000207050] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000062428
SMART Domains Protein: ENSMUSP00000051979
Gene: ENSMUSG00000043290

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
ZnF_C2H2 64 86 1.02e1 SMART
ZnF_C2H2 100 122 9.96e-1 SMART
ZnF_C2H2 128 150 6.67e-2 SMART
low complexity region 180 192 N/A INTRINSIC
ZnF_C2H2 195 217 4.11e-2 SMART
ZnF_C2H2 223 245 7.26e-3 SMART
ZnF_C2H2 251 273 3.21e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076251
AA Change: I145T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405
AA Change: I145T

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076791
Predicted Effect possibly damaging
Transcript: ENSMUST00000085427
AA Change: I145T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405
AA Change: I145T

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207362
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Meta Mutation Damage Score 0.0881 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Other mutations in Zfp865
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Zfp865 APN 7 5029876 missense probably benign
IGL02041:Zfp865 APN 7 5031373 missense probably benign
IGL03118:Zfp865 APN 7 5034645 intron probably benign
R0613:Zfp865 UTSW 7 5029091 missense possibly damaging 0.86
R0879:Zfp865 UTSW 7 5031343 missense probably benign
R0938:Zfp865 UTSW 7 5031404 missense possibly damaging 0.96
R1448:Zfp865 UTSW 7 5029279 nonsense probably null
R3955:Zfp865 UTSW 7 5032014 missense probably damaging 0.96
R4841:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R4842:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R5044:Zfp865 UTSW 7 5034669 intron probably benign
R5773:Zfp865 UTSW 7 5034694 intron probably benign
R5843:Zfp865 UTSW 7 5030417 missense probably benign 0.03
R5849:Zfp865 UTSW 7 5031087 missense probably damaging 1.00
R6393:Zfp865 UTSW 7 5030066 missense probably damaging 1.00
R6480:Zfp865 UTSW 7 5029783 missense probably damaging 0.98
R6880:Zfp865 UTSW 7 5030549 missense probably damaging 1.00
R7252:Zfp865 UTSW 7 5034417 intron probably benign
R7302:Zfp865 UTSW 7 5029253 missense possibly damaging 0.96
R7486:Zfp865 UTSW 7 5031260 missense possibly damaging 0.85
R7611:Zfp865 UTSW 7 5031131 missense probably damaging 0.99
R8058:Zfp865 UTSW 7 5030446 missense probably benign
R8327:Zfp865 UTSW 7 5031059 missense probably benign 0.08
R8728:Zfp865 UTSW 7 5031820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTTTCAAACCCAAGGCGG -3'
(R):5'- CATCAGGTACTTCAGCCTTCG -3'

Sequencing Primer
(F):5'- atcCTCTTCCCAAGCCAA -3'
(R):5'- GGTACTTCAGCCTTCGGAAATAGC -3'
Posted On2018-07-23