Incidental Mutation 'R6681:Kbtbd3'
ID527503
Institutional Source Beutler Lab
Gene Symbol Kbtbd3
Ensembl Gene ENSMUSG00000025893
Gene Namekelch repeat and BTB (POZ) domain containing 3
SynonymsBklhd3, 2200003A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location4309833-4331732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4330687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 354 (I354F)
Ref Sequence ENSEMBL: ENSMUSP00000148445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000212221]
Predicted Effect probably benign
Transcript: ENSMUST00000049648
AA Change: I354F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893
AA Change: I354F

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212221
AA Change: I354F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Kbtbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Kbtbd3 APN 9 4330169 missense probably benign
IGL00674:Kbtbd3 APN 9 4329949 missense probably benign 0.05
IGL00848:Kbtbd3 APN 9 4331184 missense probably damaging 1.00
IGL01949:Kbtbd3 APN 9 4331066 missense possibly damaging 0.95
IGL02619:Kbtbd3 APN 9 4331252 missense probably damaging 1.00
IGL02830:Kbtbd3 APN 9 4330096 missense possibly damaging 0.95
IGL02894:Kbtbd3 APN 9 4331444 missense probably benign 0.05
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0348:Kbtbd3 UTSW 9 4330519 missense possibly damaging 0.94
R0372:Kbtbd3 UTSW 9 4316950 missense possibly damaging 0.75
R0380:Kbtbd3 UTSW 9 4330545 nonsense probably null
R0644:Kbtbd3 UTSW 9 4329868 missense probably damaging 1.00
R1496:Kbtbd3 UTSW 9 4330276 missense probably benign
R1651:Kbtbd3 UTSW 9 4330589 missense possibly damaging 0.62
R1707:Kbtbd3 UTSW 9 4316985 missense probably benign 0.01
R1998:Kbtbd3 UTSW 9 4330760 missense probably benign 0.01
R2012:Kbtbd3 UTSW 9 4330919 missense probably benign
R2027:Kbtbd3 UTSW 9 4317075 splice site probably benign
R3717:Kbtbd3 UTSW 9 4330598 missense probably benign
R4463:Kbtbd3 UTSW 9 4331257 missense probably damaging 0.99
R4482:Kbtbd3 UTSW 9 4331051 missense probably damaging 1.00
R4795:Kbtbd3 UTSW 9 4331073 nonsense probably null
R5195:Kbtbd3 UTSW 9 4316905 missense possibly damaging 0.74
R5645:Kbtbd3 UTSW 9 4331426 missense possibly damaging 0.92
R5753:Kbtbd3 UTSW 9 4331404 missense possibly damaging 0.74
R5898:Kbtbd3 UTSW 9 4330476 missense probably damaging 0.97
R6463:Kbtbd3 UTSW 9 4316921 missense probably benign
R7284:Kbtbd3 UTSW 9 4330690 nonsense probably null
R7390:Kbtbd3 UTSW 9 4330424 missense probably benign 0.27
R7735:Kbtbd3 UTSW 9 4330846 missense possibly damaging 0.89
R7793:Kbtbd3 UTSW 9 4331221 missense probably damaging 1.00
R8005:Kbtbd3 UTSW 9 4330655 missense not run
R8050:Kbtbd3 UTSW 9 4330408 missense not run
X0024:Kbtbd3 UTSW 9 4331437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCGACCATCCACAACTG -3'
(R):5'- AGACTTTTAATGTCCTGGGACC -3'

Sequencing Primer
(F):5'- ATTCATCCATAAGACTGAGGAAAATG -3'
(R):5'- AATGTCCTGGGACCCTCTAG -3'
Posted On2018-07-23