Incidental Mutation 'R6681:Sgsm2'
ID527510
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Namesmall G protein signaling modulator 2
SynonymsD630003G22Rik, Rutbc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74849261-74897060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74865378 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 382 (W382R)
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
Predicted Effect probably damaging
Transcript: ENSMUST00000057631
AA Change: W382R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: W382R

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081799
AA Change: W382R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: W382R

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184562
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGCTTGGGGAAAACCTTGCC -3'
(R):5'- AAATCTCACCTGTTGGGCC -3'

Sequencing Primer
(F):5'- AAAACCTTGCCCTGCGGAG -3'
(R):5'- GGTCTCAAGAAGGACCCCAG -3'
Posted On2018-07-23