Incidental Mutation 'R6681:Ttll6'
ID527512
Institutional Source Beutler Lab
Gene Symbol Ttll6
Ensembl Gene ENSMUSG00000038756
Gene Nametubulin tyrosine ligase-like family, member 6
SynonymsD11Moh43e, t8130b59, 4932418K24Rik, D11Moh44e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location96133786-96165451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96138863 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 201 (C201S)
Ref Sequence ENSEMBL: ENSMUSP00000127778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107680] [ENSMUST00000167258]
Predicted Effect probably damaging
Transcript: ENSMUST00000107680
AA Change: C97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103307
Gene: ENSMUSG00000038756
AA Change: C97S

DomainStartEndE-ValueType
Pfam:TTL 1 293 4.4e-90 PFAM
coiled coil region 376 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167258
AA Change: C201S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127778
Gene: ENSMUSG00000038756
AA Change: C201S

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
Pfam:TTL 103 397 2.9e-90 PFAM
coiled coil region 480 506 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Ttll6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ttll6 APN 11 96135540 nonsense probably null
IGL02331:Ttll6 APN 11 96135747 missense probably damaging 1.00
IGL02490:Ttll6 APN 11 96156720 missense possibly damaging 0.55
IGL02551:Ttll6 APN 11 96154700 missense probably benign 0.00
IGL02618:Ttll6 APN 11 96147562 missense probably benign 0.04
IGL02712:Ttll6 APN 11 96139775 critical splice donor site probably benign
IGL02720:Ttll6 APN 11 96152073 critical splice donor site probably null
IGL02839:Ttll6 APN 11 96158820 missense probably damaging 1.00
IGL02974:Ttll6 APN 11 96156702 missense probably benign 0.06
IGL03038:Ttll6 APN 11 96151960 missense probably damaging 1.00
IGL03216:Ttll6 APN 11 96152014 missense probably benign 0.00
IGL03271:Ttll6 APN 11 96156687 missense probably benign 0.00
LCD18:Ttll6 UTSW 11 96155258 intron probably benign
R0295:Ttll6 UTSW 11 96154714 missense probably benign 0.09
R0310:Ttll6 UTSW 11 96147556 missense probably benign 0.41
R0466:Ttll6 UTSW 11 96145591 missense probably damaging 1.00
R0533:Ttll6 UTSW 11 96154756 missense probably benign 0.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1453:Ttll6 UTSW 11 96158888 missense possibly damaging 0.82
R1555:Ttll6 UTSW 11 96145582 missense probably damaging 1.00
R1860:Ttll6 UTSW 11 96138874 nonsense probably null
R1861:Ttll6 UTSW 11 96138874 nonsense probably null
R1998:Ttll6 UTSW 11 96139775 critical splice donor site probably null
R2034:Ttll6 UTSW 11 96135526 missense probably damaging 0.99
R2126:Ttll6 UTSW 11 96147532 missense probably damaging 1.00
R3722:Ttll6 UTSW 11 96133921 missense probably benign 0.00
R4684:Ttll6 UTSW 11 96153177 missense probably benign
R4747:Ttll6 UTSW 11 96145546 missense possibly damaging 0.46
R4771:Ttll6 UTSW 11 96133829 missense possibly damaging 0.53
R4955:Ttll6 UTSW 11 96138789 missense possibly damaging 0.87
R5042:Ttll6 UTSW 11 96154604 missense possibly damaging 0.95
R5910:Ttll6 UTSW 11 96135589 missense possibly damaging 0.90
R5951:Ttll6 UTSW 11 96145510 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6134:Ttll6 UTSW 11 96139742 missense possibly damaging 0.69
R6263:Ttll6 UTSW 11 96156545 missense probably benign
R6325:Ttll6 UTSW 11 96135505 missense probably damaging 1.00
R6395:Ttll6 UTSW 11 96156588 missense probably benign 0.05
R6453:Ttll6 UTSW 11 96158727 missense probably benign 0.00
R7481:Ttll6 UTSW 11 96154846 missense probably benign
R7574:Ttll6 UTSW 11 96134875 missense probably damaging 0.99
R8130:Ttll6 UTSW 11 96156599 missense probably benign 0.05
R8771:Ttll6 UTSW 11 96151936 missense probably damaging 1.00
R8887:Ttll6 UTSW 11 96156666 missense possibly damaging 0.69
X0022:Ttll6 UTSW 11 96158741 missense probably damaging 0.99
Z1176:Ttll6 UTSW 11 96134897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGTGTGTCTTGTCCCCTC -3'
(R):5'- TCAGCCATTTGAGGGAGAGG -3'

Sequencing Primer
(F):5'- GTCCCCTCCCTGCTGTGATAG -3'
(R):5'- CCATTTGAGGGAGAGGTCGGC -3'
Posted On2018-07-23