Incidental Mutation 'R6681:Gpatch11'
ID 527517
Institutional Source Beutler Lab
Gene Symbol Gpatch11
Ensembl Gene ENSMUSG00000050668
Gene Name G patch domain containing 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R6681 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78835516-78848299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78840099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 103 (I103T)
Ref Sequence ENSEMBL: ENSMUSP00000126814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281] [ENSMUST00000170759]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000097281
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170759
AA Change: I103T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126814
Gene: ENSMUSG00000050668
AA Change: I103T

DomainStartEndE-ValueType
G_patch 71 117 5.8e-14 SMART
DUF4187 195 263 1.51e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Gpatch11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Gpatch11 APN 17 78842164 missense probably benign
IGL02125:Gpatch11 APN 17 78840109 missense probably benign 0.21
IGL02183:Gpatch11 APN 17 78842231 critical splice donor site probably null
IGL02223:Gpatch11 APN 17 78845179 missense probably benign 0.23
IGL02224:Gpatch11 APN 17 78841093 splice site probably benign
IGL03116:Gpatch11 APN 17 78843853 nonsense probably null
FR4340:Gpatch11 UTSW 17 78842174 small insertion probably benign
FR4342:Gpatch11 UTSW 17 78842178 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842168 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842176 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842181 small insertion probably benign
FR4548:Gpatch11 UTSW 17 78842175 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842180 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842170 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842172 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842173 nonsense probably null
FR4976:Gpatch11 UTSW 17 78842180 small insertion probably benign
R1670:Gpatch11 UTSW 17 78839100 missense possibly damaging 0.85
R1986:Gpatch11 UTSW 17 78843837 missense probably benign 0.04
R2071:Gpatch11 UTSW 17 78841085 critical splice donor site probably null
R3056:Gpatch11 UTSW 17 78843843 missense probably damaging 1.00
R4348:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R4352:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R5426:Gpatch11 UTSW 17 78841234 missense possibly damaging 0.47
R5546:Gpatch11 UTSW 17 78842119 nonsense probably null
R7221:Gpatch11 UTSW 17 78842117 missense possibly damaging 0.69
R7409:Gpatch11 UTSW 17 78839166 missense probably damaging 1.00
R7662:Gpatch11 UTSW 17 78839055 missense probably benign 0.44
R8906:Gpatch11 UTSW 17 78837860 missense probably benign 0.17
R9265:Gpatch11 UTSW 17 78839118 missense probably benign 0.11
R9277:Gpatch11 UTSW 17 78841017 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TACTGAGAAGGAGGTACTTAAACAC -3'
(R):5'- ATGGACTAGGTAGACAGGCACC -3'

Sequencing Primer
(F):5'- GAGGTACTTAAACACAGGAGAGG -3'
(R):5'- CAAGGTCTTACTATGTAGCCAGGC -3'
Posted On 2018-07-23