Incidental Mutation 'R6681:Gpatch11'
ID527517
Institutional Source Beutler Lab
Gene Symbol Gpatch11
Ensembl Gene ENSMUSG00000050668
Gene NameG patch domain containing 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78835516-78848299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78840099 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 103 (I103T)
Ref Sequence ENSEMBL: ENSMUSP00000126814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281] [ENSMUST00000170759]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170759
AA Change: I103T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126814
Gene: ENSMUSG00000050668
AA Change: I103T

DomainStartEndE-ValueType
G_patch 71 117 5.8e-14 SMART
DUF4187 195 263 1.51e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Vmn1r45 T A 6: 89,934,003 probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Gpatch11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Gpatch11 APN 17 78842164 missense probably benign
IGL02125:Gpatch11 APN 17 78840109 missense probably benign 0.21
IGL02183:Gpatch11 APN 17 78842231 critical splice donor site probably null
IGL02223:Gpatch11 APN 17 78845179 missense probably benign 0.23
IGL02224:Gpatch11 APN 17 78841093 splice site probably benign
IGL03116:Gpatch11 APN 17 78843853 nonsense probably null
FR4340:Gpatch11 UTSW 17 78842174 small insertion probably benign
FR4342:Gpatch11 UTSW 17 78842178 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842168 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842176 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842181 small insertion probably benign
FR4548:Gpatch11 UTSW 17 78842175 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842180 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842170 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842172 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842173 nonsense probably null
FR4976:Gpatch11 UTSW 17 78842180 small insertion probably benign
R1670:Gpatch11 UTSW 17 78839100 missense possibly damaging 0.85
R1986:Gpatch11 UTSW 17 78843837 missense probably benign 0.04
R2071:Gpatch11 UTSW 17 78841085 critical splice donor site probably null
R3056:Gpatch11 UTSW 17 78843843 missense probably damaging 1.00
R4348:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R4352:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R5426:Gpatch11 UTSW 17 78841234 missense possibly damaging 0.47
R5546:Gpatch11 UTSW 17 78842119 nonsense probably null
R7221:Gpatch11 UTSW 17 78842117 missense possibly damaging 0.69
R7409:Gpatch11 UTSW 17 78839166 missense probably damaging 1.00
R7662:Gpatch11 UTSW 17 78839055 missense probably benign 0.44
R8906:Gpatch11 UTSW 17 78837860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TACTGAGAAGGAGGTACTTAAACAC -3'
(R):5'- ATGGACTAGGTAGACAGGCACC -3'

Sequencing Primer
(F):5'- GAGGTACTTAAACACAGGAGAGG -3'
(R):5'- CAAGGTCTTACTATGTAGCCAGGC -3'
Posted On2018-07-23