Incidental Mutation 'R6682:Trpm8'
ID527522
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Nametransient receptor potential cation channel, subfamily M, member 8
SynonymsCMR1, Trp-p8, TRPP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location88277661-88389293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88326502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 149 (T149K)
Ref Sequence ENSEMBL: ENSMUSP00000131209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
Predicted Effect probably damaging
Transcript: ENSMUST00000040210
AA Change: T149K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: T149K

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113114
AA Change: T149K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: T149K

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171176
AA Change: T149K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: T149K

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88379827 missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88343287 missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88326405 missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88325488 missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88330694 critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88328250 missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88360716 missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88348051 missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88348108 missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88328148 splice site probably benign
R1183:Trpm8 UTSW 1 88348091 missense probably damaging 1.00
R1608:Trpm8 UTSW 1 88326432 missense probably benign
R1713:Trpm8 UTSW 1 88365080 missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88350856 missense possibly damaging 0.86
R1966:Trpm8 UTSW 1 88332748 splice site probably null
R2089:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88359656 missense probably benign 0.00
R2475:Trpm8 UTSW 1 88354449 missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88328196 missense probably benign 0.00
R3745:Trpm8 UTSW 1 88348327 missense probably benign 0.21
R4063:Trpm8 UTSW 1 88362005 missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88337129 missense probably benign 0.07
R4681:Trpm8 UTSW 1 88384705 missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88348188 missense probably benign 0.00
R5620:Trpm8 UTSW 1 88359651 critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88359739 missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88355280 missense probably benign 0.01
R5839:Trpm8 UTSW 1 88325506 missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88384711 makesense probably null
R5845:Trpm8 UTSW 1 88328180 missense probably benign 0.00
R5926:Trpm8 UTSW 1 88330747 missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88351415 nonsense probably null
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88306678 start gained probably benign
R6283:Trpm8 UTSW 1 88348332 missense probably benign 0.09
R6299:Trpm8 UTSW 1 88354479 missense probably damaging 1.00
R6367:Trpm8 UTSW 1 88359683 missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88361998 missense probably damaging 0.98
R6751:Trpm8 UTSW 1 88384706 missense possibly damaging 0.63
R7057:Trpm8 UTSW 1 88362080 missense probably null 0.99
R7489:Trpm8 UTSW 1 88379759 missense possibly damaging 0.85
R7520:Trpm8 UTSW 1 88343321 missense probably benign 0.00
R7597:Trpm8 UTSW 1 88328196 missense probably damaging 0.97
R7774:Trpm8 UTSW 1 88330841 missense probably damaging 0.99
R7839:Trpm8 UTSW 1 88326454 missense possibly damaging 0.83
R7948:Trpm8 UTSW 1 88374369 nonsense probably null
R8176:Trpm8 UTSW 1 88365115 missense probably benign 0.06
R8222:Trpm8 UTSW 1 88325668 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACTTTCCTATGAGGCTCTGG -3'
(R):5'- ACTCTGTGGGAAAGTGACATG -3'

Sequencing Primer
(F):5'- TGCCTAGGACACCCTGTC -3'
(R):5'- GACATGTGGAAACTATGTTCCCAGC -3'
Posted On2018-07-23