Incidental Mutation 'R6682:Zfp704'
ID 527527
Institutional Source Beutler Lab
Gene Symbol Zfp704
Ensembl Gene ENSMUSG00000040209
Gene Name zinc finger protein 704
Synonyms Gig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 9427020-9610085 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9565193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 36 (E36G)
Ref Sequence ENSEMBL: ENSMUSP00000141598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041124] [ENSMUST00000193947]
AlphaFold Q9ERQ3
Predicted Effect probably benign
Transcript: ENSMUST00000041124
AA Change: E186G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041242
Gene: ENSMUSG00000040209
AA Change: E186G

DomainStartEndE-ValueType
low complexity region 12 94 N/A INTRINSIC
low complexity region 98 129 N/A INTRINSIC
low complexity region 267 290 N/A INTRINSIC
ZnF_C2H2 346 371 3.58e-2 SMART
c-clamp 536 566 1.55e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193947
AA Change: E36G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141598
Gene: ENSMUSG00000040209
AA Change: E36G

DomainStartEndE-ValueType
low complexity region 117 140 N/A INTRINSIC
ZnF_C2H2 196 221 1.6e-4 SMART
c-clamp 475 505 7.4e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile with no obvious developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Zfp704
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Zfp704 APN 3 9565239 missense possibly damaging 0.61
IGL03288:Zfp704 APN 3 9439891 splice site probably benign
R0265:Zfp704 UTSW 3 9565157 missense probably damaging 1.00
R0524:Zfp704 UTSW 3 9609364 missense unknown
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1647:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1648:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1865:Zfp704 UTSW 3 9474491 splice site probably benign
R1912:Zfp704 UTSW 3 9609358 missense unknown
R2109:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R2566:Zfp704 UTSW 3 9609493 missense unknown
R3551:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R4495:Zfp704 UTSW 3 9471077 missense probably benign 0.01
R6165:Zfp704 UTSW 3 9443886 missense probably benign 0.00
R7057:Zfp704 UTSW 3 9470917 missense probably damaging 1.00
R7348:Zfp704 UTSW 3 9474598 missense probably damaging 1.00
R7758:Zfp704 UTSW 3 9444222 missense possibly damaging 0.90
R7858:Zfp704 UTSW 3 9444157 critical splice donor site probably null
R8104:Zfp704 UTSW 3 9565241 missense probably benign 0.03
R8373:Zfp704 UTSW 3 9609442 missense unknown
R8877:Zfp704 UTSW 3 9609356 missense unknown
R9136:Zfp704 UTSW 3 9444264 missense probably benign 0.03
Z1176:Zfp704 UTSW 3 9471044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGACAGACAGCTCTTGC -3'
(R):5'- GAGTAGTCTCTCTTCACCACAGC -3'

Sequencing Primer
(F):5'- CTTGCTAAGTCTAGACCCTGTGAAAC -3'
(R):5'- TCTTCACCACAGCCCTGCAG -3'
Posted On 2018-07-23