Incidental Mutation 'R6682:Cpt2'
ID 527530
Institutional Source Beutler Lab
Gene Symbol Cpt2
Ensembl Gene ENSMUSG00000028607
Gene Name carnitine palmitoyltransferase 2
Synonyms CPT II, CPTII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6682 (G1)
Quality Score 206.009
Status Not validated
Chromosome 4
Chromosomal Location 107903981-107923610 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 107904430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 158 (S158R)
Ref Sequence ENSEMBL: ENSMUSP00000102331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030345] [ENSMUST00000106719] [ENSMUST00000106720] [ENSMUST00000131644]
AlphaFold P52825
Predicted Effect possibly damaging
Transcript: ENSMUST00000030345
AA Change: S593R

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030345
Gene: ENSMUSG00000028607
AA Change: S593R

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 49 648 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106719
SMART Domains Protein: ENSMUSP00000102330
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 265 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106720
AA Change: S158R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102331
Gene: ENSMUSG00000028607
AA Change: S158R

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 113 2.1e-21 PFAM
Pfam:Carn_acyltransf 101 214 1.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131644
SMART Domains Protein: ENSMUSP00000114362
Gene: ENSMUSG00000028607

DomainStartEndE-ValueType
PDB:4EYW|B 27 88 2e-28 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Cpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02655:Cpt2 APN 4 107907427 missense probably damaging 1.00
IGL02755:Cpt2 APN 4 107907775 missense probably damaging 1.00
IGL02803:Cpt2 APN 4 107907386 missense probably benign
IGL03066:Cpt2 APN 4 107907986 missense probably benign 0.01
IGL03180:Cpt2 APN 4 107906960 missense probably damaging 1.00
R0037:Cpt2 UTSW 4 107907974 missense probably damaging 0.99
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0598:Cpt2 UTSW 4 107906938 missense probably damaging 1.00
R1844:Cpt2 UTSW 4 107904255 missense possibly damaging 0.68
R2432:Cpt2 UTSW 4 107904526 nonsense probably null
R6326:Cpt2 UTSW 4 107914316 missense probably benign 0.00
R6803:Cpt2 UTSW 4 107912664 missense probably damaging 1.00
R7463:Cpt2 UTSW 4 107908157 missense probably damaging 1.00
R7491:Cpt2 UTSW 4 107907142 missense probably damaging 1.00
R7572:Cpt2 UTSW 4 107907548 missense probably damaging 1.00
R7645:Cpt2 UTSW 4 107906974 missense possibly damaging 0.92
R8480:Cpt2 UTSW 4 107907760 missense probably damaging 1.00
R8513:Cpt2 UTSW 4 107906926 missense probably damaging 1.00
R9323:Cpt2 UTSW 4 107904359 missense probably benign 0.00
R9523:Cpt2 UTSW 4 107907157 missense probably damaging 1.00
R9608:Cpt2 UTSW 4 107908144 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTTTTCATCGACCAAGAAG -3'
(R):5'- TCACTGTGAGGTCCTGAGAG -3'

Sequencing Primer
(F):5'- GGCTTTTCATCGACCAAGAAGCTAAG -3'
(R):5'- AGGTCCTGAGAGTCTGAATTTTC -3'
Posted On 2018-07-23