Incidental Mutation 'R6682:Grik3'
ID 527531
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 044801-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R6682 (G1)
Quality Score 122.008
Status Not validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125544259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 327 (Y327N)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: Y327N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: Y327N

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,385,460 (GRCm39) V368A possibly damaging Het
Bcl9l A G 9: 44,412,400 (GRCm39) T92A possibly damaging Het
Celsr2 A T 3: 108,307,817 (GRCm39) probably null Het
Cndp2 T C 18: 84,695,455 (GRCm39) K149E probably benign Het
Cnpy4 T C 5: 138,185,984 (GRCm39) probably null Het
Cox6c A T 15: 35,938,319 (GRCm39) probably null Het
Cpt2 G T 4: 107,761,627 (GRCm39) S158R probably damaging Het
Dlgap1 A G 17: 71,094,118 (GRCm39) K813R probably damaging Het
Dock10 A C 1: 80,490,338 (GRCm39) L1927R probably damaging Het
Gak T A 5: 108,746,742 (GRCm39) K430I probably damaging Het
Ldb3 T A 14: 34,274,221 (GRCm39) T334S possibly damaging Het
Ldlr A G 9: 21,643,671 (GRCm39) D85G probably benign Het
Med26 T A 8: 73,249,927 (GRCm39) T391S probably benign Het
Mmp27 A G 9: 7,573,606 (GRCm39) T233A probably benign Het
Mob1a A G 6: 83,311,132 (GRCm39) Y117C possibly damaging Het
Mrps35 A T 6: 146,949,777 (GRCm39) E97V possibly damaging Het
Msln A T 17: 25,971,993 (GRCm39) S75T probably damaging Het
Myoz1 C T 14: 20,703,687 (GRCm39) probably null Het
Nim1k A G 13: 120,173,724 (GRCm39) I390T probably benign Het
Or10k2 A G 8: 84,268,187 (GRCm39) H138R probably benign Het
Or4k51 C T 2: 111,584,980 (GRCm39) P129S probably damaging Het
Pclo A C 5: 14,589,893 (GRCm39) Q731P unknown Het
Prl3d3 G A 13: 27,345,023 (GRCm39) E132K probably benign Het
Pth1r C T 9: 110,556,319 (GRCm39) probably null Het
Ptpru T C 4: 131,548,093 (GRCm39) M135V probably benign Het
Slc12a9 A T 5: 137,325,663 (GRCm39) L316Q probably damaging Het
Slc35f6 G A 5: 30,814,764 (GRCm39) M177I possibly damaging Het
Smc4 T A 3: 68,914,574 (GRCm39) S62R probably damaging Het
Tmem179 C T 12: 112,469,714 (GRCm39) D29N probably benign Het
Togaram2 A T 17: 72,011,749 (GRCm39) D476V probably benign Het
Trpc4ap C T 2: 155,479,687 (GRCm39) probably null Het
Trpm8 C A 1: 88,254,224 (GRCm39) T149K probably damaging Het
Uhmk1 C T 1: 170,039,804 (GRCm39) probably null Het
Vmn2r79 C A 7: 86,653,370 (GRCm39) T545K possibly damaging Het
Vmn2r95 C A 17: 18,660,489 (GRCm39) N300K probably damaging Het
Wdr41 G A 13: 95,149,639 (GRCm39) G419D probably damaging Het
Zc3hav1 A T 6: 38,302,130 (GRCm39) H597Q probably benign Het
Zfp704 T C 3: 9,630,253 (GRCm39) E36G probably benign Het
Zfp9 A G 6: 118,444,202 (GRCm39) V47A possibly damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0208:Grik3 UTSW 4 125,579,958 (GRCm39) missense probably damaging 1.00
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1515:Grik3 UTSW 4 125,564,521 (GRCm39) missense probably benign 0.37
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5093:Grik3 UTSW 4 125,564,382 (GRCm39) missense probably benign
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7790:Grik3 UTSW 4 125,579,812 (GRCm39) missense probably damaging 1.00
R7822:Grik3 UTSW 4 125,550,190 (GRCm39) critical splice donor site probably null
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTATCCATAGACTAACAGGGCC -3'
(R):5'- TTCTGAGCCCCAAACCTGAG -3'

Sequencing Primer
(F):5'- CACTGAGGCTGGTCTGTCTTCAG -3'
(R):5'- TCTATGACTGAGCACTGGAGGC -3'
Posted On 2018-07-23