Mutagenetix > Incidental Mutation

Incidental Mutation 'R6682:Grik3'

527531

Institutional Source

Beutler Lab

Gene Symbol

Grik3

Ensembl Gene

ENSMUSG00000001985

Gene Name

glutamate receptor, ionotropic, kainate 3

Synonyms

Glur7, Glur-7

MMRRC Submission

044801-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R6682 (G1)

Quality Score

122.008

Status

Not validated

Chromosome

Chromosomal Location

125490700-125714173 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125650466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 327 (Y327N)

Ref Sequence

ENSEMBL: ENSMUSP00000030676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030676]

AlphaFold

B1AS29

Predicted Effect

probably damaging
Transcript: ENSMUST00000030676
AA Change: Y327N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: Y327N

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	55	398	7.8e-72	PFAM
PBPe	435	802	4.38e-133	SMART
Lig_chan-Glu_bd	445	509	5.77e-34	SMART
transmembrane domain	823	845	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aspm	T	C	1: 139,457,722	V368A	possibly damaging	Het
Bcl9l	A	G	9: 44,501,103	T92A	possibly damaging	Het
Celsr2	A	T	3: 108,400,501		probably null	Het
Cndp2	T	C	18: 84,677,330	K149E	probably benign	Het
Cnpy4	T	C	5: 138,187,722		probably null	Het
Cox6c	A	T	15: 35,938,173		probably null	Het
Cpt2	G	T	4: 107,904,430	S158R	probably damaging	Het
Dlgap1	A	G	17: 70,787,123	K813R	probably damaging	Het
Dock10	A	C	1: 80,512,621	L1927R	probably damaging	Het
Gak	T	A	5: 108,598,876	K430I	probably damaging	Het
Ldb3	T	A	14: 34,552,264	T334S	possibly damaging	Het
Ldlr	A	G	9: 21,732,375	D85G	probably benign	Het
Med26	T	A	8: 72,496,083	T391S	probably benign	Het
Mmp27	A	G	9: 7,573,605	T233A	probably benign	Het
Mob1a	A	G	6: 83,334,150	Y117C	possibly damaging	Het
Mrps35	A	T	6: 147,048,279	E97V	possibly damaging	Het
Msln	A	T	17: 25,753,019	S75T	probably damaging	Het
Myoz1	C	T	14: 20,653,619		probably null	Het
Nim1k	A	G	13: 119,712,188	I390T	probably benign	Het
Olfr1301	C	T	2: 111,754,635	P129S	probably damaging	Het
Olfr370	A	G	8: 83,541,558	H138R	probably benign	Het
Pclo	A	C	5: 14,539,879	Q731P	unknown	Het
Prl3d3	G	A	13: 27,161,040	E132K	probably benign	Het
Pth1r	C	T	9: 110,727,251		probably null	Het
Ptpru	T	C	4: 131,820,782	M135V	probably benign	Het
Slc12a9	A	T	5: 137,327,401	L316Q	probably damaging	Het
Slc35f6	G	A	5: 30,657,420	M177I	possibly damaging	Het
Smc4	T	A	3: 69,007,241	S62R	probably damaging	Het
Tmem179	C	T	12: 112,503,280	D29N	probably benign	Het
Togaram2	A	T	17: 71,704,754	D476V	probably benign	Het
Trpc4ap	C	T	2: 155,637,767		probably null	Het
Trpm8	C	A	1: 88,326,502	T149K	probably damaging	Het
Uhmk1	C	T	1: 170,212,235		probably null	Het
Vmn2r79	C	A	7: 87,004,162	T545K	possibly damaging	Het
Vmn2r95	C	A	17: 18,440,227	N300K	probably damaging	Het
Wdr41	G	A	13: 95,013,131	G419D	probably damaging	Het
Zc3hav1	A	T	6: 38,325,195	H597Q	probably benign	Het
Zfp704	T	C	3: 9,565,193	E36G	probably benign	Het
Zfp9	A	G	6: 118,467,241	V47A	possibly damaging	Het

Other mutations in Grik3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Grik3	APN	4	125632415	missense	probably benign
IGL01534:Grik3	APN	4	125686190	missense	probably damaging	1.00
IGL01538:Grik3	APN	4	125694036	missense	possibly damaging	0.90
IGL02276:Grik3	APN	4	125623502	missense	possibly damaging	0.86
IGL02323:Grik3	APN	4	125685990	splice site	probably benign
IGL02475:Grik3	APN	4	125650517	missense	probably benign
IGL03198:Grik3	APN	4	125659762	missense	probably benign	0.25
IGL03307:Grik3	APN	4	125641554	missense	possibly damaging	0.91
R0054:Grik3	UTSW	4	125623575	missense	probably damaging	1.00
R0054:Grik3	UTSW	4	125623575	missense	probably damaging	1.00
R0116:Grik3	UTSW	4	125670556	missense	probably benign	0.01
R0208:Grik3	UTSW	4	125686165	missense	probably damaging	1.00
R0497:Grik3	UTSW	4	125623510	missense	possibly damaging	0.82
R1295:Grik3	UTSW	4	125704564	splice site	probably benign
R1296:Grik3	UTSW	4	125704564	splice site	probably benign
R1515:Grik3	UTSW	4	125670728	missense	probably benign	0.37
R1559:Grik3	UTSW	4	125707997	missense	probably benign	0.16
R1617:Grik3	UTSW	4	125691192	missense	probably benign
R1848:Grik3	UTSW	4	125694138	missense	probably damaging	1.00
R2903:Grik3	UTSW	4	125670644	missense	probably damaging	1.00
R3440:Grik3	UTSW	4	125693970	missense	probably damaging	1.00
R3440:Grik3	UTSW	4	125693971	missense	probably damaging	1.00
R3442:Grik3	UTSW	4	125693970	missense	probably damaging	1.00
R3442:Grik3	UTSW	4	125693971	missense	probably damaging	1.00
R3842:Grik3	UTSW	4	125693954	splice site	probably benign
R4649:Grik3	UTSW	4	125650485	missense	probably damaging	1.00
R4841:Grik3	UTSW	4	125691176	missense	probably damaging	1.00
R4842:Grik3	UTSW	4	125691176	missense	probably damaging	1.00
R5093:Grik3	UTSW	4	125670589	missense	probably benign
R5318:Grik3	UTSW	4	125694136	missense	probably damaging	0.96
R5549:Grik3	UTSW	4	125686045	missense	possibly damaging	0.95
R6221:Grik3	UTSW	4	125705123	missense	probably damaging	0.99
R6226:Grik3	UTSW	4	125659789	missense	probably benign	0.04
R6306:Grik3	UTSW	4	125632412	missense	probably benign	0.01
R6672:Grik3	UTSW	4	125623516	missense	probably benign	0.08
R6783:Grik3	UTSW	4	125632300	missense	probably benign	0.01
R7390:Grik3	UTSW	4	125649739	missense	probably damaging	1.00
R7604:Grik3	UTSW	4	125623635	missense	probably damaging	0.97
R7790:Grik3	UTSW	4	125686019	missense	probably damaging	1.00
R7822:Grik3	UTSW	4	125656397	critical splice donor site	probably null
R7952:Grik3	UTSW	4	125704547	missense	probably damaging	1.00
R8418:Grik3	UTSW	4	125686042	missense	possibly damaging	0.95
R8769:Grik3	UTSW	4	125656373	missense	probably damaging	1.00
R9030:Grik3	UTSW	4	125632392	missense	probably benign	0.24
R9243:Grik3	UTSW	4	125707897	missense	probably benign	0.00
R9792:Grik3	UTSW	4	125632522	missense	probably damaging	0.97
R9793:Grik3	UTSW	4	125632522	missense	probably damaging	0.97
Z1177:Grik3	UTSW	4	125650506	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTATCCATAGACTAACAGGGCC -3'
(R):5'- TTCTGAGCCCCAAACCTGAG -3'

Sequencing Primer
(F):5'- CACTGAGGCTGGTCTGTCTTCAG -3'
(R):5'- TCTATGACTGAGCACTGGAGGC -3'

Posted On

2018-07-23