Incidental Mutation 'R6682:Slc35f6'
ID 527534
Institutional Source Beutler Lab
Gene Symbol Slc35f6
Ensembl Gene ENSMUSG00000029175
Gene Name solute carrier family 35, member F6
Synonyms Tango9, 5730478O19Rik, 4930471M23Rik, p40
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30647933-30659729 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30657420 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 177 (M177I)
Ref Sequence ENSEMBL: ENSMUSP00000142761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062962] [ENSMUST00000124474] [ENSMUST00000143867] [ENSMUST00000196740]
AlphaFold Q8VE96
Predicted Effect possibly damaging
Transcript: ENSMUST00000062962
AA Change: M230I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058680
Gene: ENSMUSG00000029175
AA Change: M230I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EamA 27 160 2.5e-9 PFAM
Pfam:Nuc_sug_transp 43 226 1.7e-12 PFAM
Pfam:SLC35F 54 233 8.8e-14 PFAM
transmembrane domain 259 281 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124474
SMART Domains Protein: ENSMUSP00000120986
Gene: ENSMUSG00000029175

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131978
Predicted Effect probably benign
Transcript: ENSMUST00000143867
SMART Domains Protein: ENSMUSP00000122703
Gene: ENSMUSG00000029175

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196740
AA Change: M177I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142761
Gene: ENSMUSG00000029175
AA Change: M177I

DomainStartEndE-ValueType
Pfam:TPT 5 104 1.1e-4 PFAM
Pfam:EamA 7 107 4.2e-8 PFAM
Pfam:Nuc_sug_transp 21 175 1.6e-10 PFAM
Pfam:DUF914 30 179 9.3e-11 PFAM
transmembrane domain 206 228 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198025
Predicted Effect probably benign
Transcript: ENSMUST00000199052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Slc35f6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4596:Slc35f6 UTSW 5 30648062 missense probably damaging 0.99
R4665:Slc35f6 UTSW 5 30655613 missense probably damaging 0.99
R4666:Slc35f6 UTSW 5 30655613 missense probably damaging 0.99
R4994:Slc35f6 UTSW 5 30648083 missense probably damaging 1.00
R6500:Slc35f6 UTSW 5 30656820 missense possibly damaging 0.90
R7107:Slc35f6 UTSW 5 30656777 missense probably damaging 1.00
R7117:Slc35f6 UTSW 5 30657707 missense probably damaging 1.00
R7219:Slc35f6 UTSW 5 30657452 missense probably benign 0.02
R7852:Slc35f6 UTSW 5 30656815 missense possibly damaging 0.88
R8292:Slc35f6 UTSW 5 30656031 missense probably benign 0.25
R9242:Slc35f6 UTSW 5 30648066 start gained probably benign
R9571:Slc35f6 UTSW 5 30657836 missense possibly damaging 0.88
Z1176:Slc35f6 UTSW 5 30657695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGTGACATCGAGGCAGAG -3'
(R):5'- AGATGACTATGGTGCGCAGG -3'

Sequencing Primer
(F):5'- GGGACAGATCCTGAGAGTGGAC -3'
(R):5'- GTGGTGGCACTCAGTTCC -3'
Posted On 2018-07-23