Incidental Mutation 'R6682:Cnpy4'
ID 527537
Institutional Source Beutler Lab
Gene Symbol Cnpy4
Ensembl Gene ENSMUSG00000036968
Gene Name canopy FGF signaling regulator 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 138187485-138193918 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 138187722 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048698] [ENSMUST00000110932] [ENSMUST00000110934] [ENSMUST00000110936] [ENSMUST00000110937] [ENSMUST00000123415] [ENSMUST00000139276] [ENSMUST00000153117]
AlphaFold Q8BQ47
Predicted Effect probably benign
Transcript: ENSMUST00000048698
SMART Domains Protein: ENSMUSP00000048016
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1e-35 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110932
SMART Domains Protein: ENSMUSP00000106557
Gene: ENSMUSG00000036968

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF3456 32 160 9.5e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110934
SMART Domains Protein: ENSMUSP00000106559
Gene: ENSMUSG00000036968

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:DUF3456 43 202 3.4e-51 PFAM
low complexity region 218 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110936
SMART Domains Protein: ENSMUSP00000106561
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:TAF6_C 308 397 1.1e-33 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110937
SMART Domains Protein: ENSMUSP00000106562
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1.9e-36 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 549 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123415
SMART Domains Protein: ENSMUSP00000122534
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130126
Predicted Effect probably benign
Transcript: ENSMUST00000139276
SMART Domains Protein: ENSMUSP00000116512
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
Pfam:TAF 11 55 2.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153117
SMART Domains Protein: ENSMUSP00000138335
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200483
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Cnpy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Cnpy4 APN 5 138192863 missense probably benign 0.00
R0317:Cnpy4 UTSW 5 138192812 nonsense probably null
R0525:Cnpy4 UTSW 5 138192616 missense probably benign 0.45
R0549:Cnpy4 UTSW 5 138187637 missense possibly damaging 0.63
R0568:Cnpy4 UTSW 5 138192577 missense probably damaging 1.00
R1889:Cnpy4 UTSW 5 138192840 missense probably benign 0.06
R2285:Cnpy4 UTSW 5 138192825 splice site probably null
R4272:Cnpy4 UTSW 5 138192591 missense probably damaging 0.98
R7283:Cnpy4 UTSW 5 138192882 missense probably benign 0.00
R7787:Cnpy4 UTSW 5 138192638 missense probably benign
R8087:Cnpy4 UTSW 5 138190270 missense probably damaging 1.00
X0065:Cnpy4 UTSW 5 138192592 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATGCGCTGACCGTTCTATG -3'
(R):5'- TAGTGCCACCTTAACCCTGC -3'

Sequencing Primer
(F):5'- GGCTTCGCCTAAATTTAAAGGGCC -3'
(R):5'- GCCACCTTAACCCTGCTTTCC -3'
Posted On 2018-07-23