Incidental Mutation 'R6682:Mrps35'
ID527541
Institutional Source Beutler Lab
Gene Symbol Mrps35
Ensembl Gene ENSMUSG00000040112
Gene Namemitochondrial ribosomal protein S35
SynonymsMRPS28, MRP-S28, MDSO23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location147042764-147073991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147048279 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 97 (E97V)
Ref Sequence ENSEMBL: ENSMUSP00000048348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036111] [ENSMUST00000137556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036111
AA Change: E97V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048348
Gene: ENSMUSG00000040112
AA Change: E97V

DomainStartEndE-ValueType
Pfam:MRP-S28 138 262 2.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137556
AA Change: E53V

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149660
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has had confusing nomenclature in the literature. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 3p, 5q, and 10q. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Mrps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Mrps35 APN 6 147055921 missense possibly damaging 0.86
IGL01776:Mrps35 APN 6 147070716 missense probably benign 0.33
IGL02134:Mrps35 APN 6 147048310 splice site probably benign
IGL03382:Mrps35 APN 6 147049875 nonsense probably null
R0600:Mrps35 UTSW 6 147070734 missense possibly damaging 0.53
R0648:Mrps35 UTSW 6 147055945 nonsense probably null
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1584:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1655:Mrps35 UTSW 6 147060228 missense possibly damaging 0.84
R2018:Mrps35 UTSW 6 147061484 nonsense probably null
R2257:Mrps35 UTSW 6 147070627 missense possibly damaging 0.85
R4989:Mrps35 UTSW 6 147060147 missense possibly damaging 0.85
R5174:Mrps35 UTSW 6 147060211 missense possibly damaging 0.93
R5453:Mrps35 UTSW 6 147070617 missense probably benign 0.32
R7181:Mrps35 UTSW 6 147055993 critical splice donor site probably null
R7409:Mrps35 UTSW 6 147055983 missense possibly damaging 0.71
R8132:Mrps35 UTSW 6 147048163 missense probably benign
X0066:Mrps35 UTSW 6 147070720 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGGACCTTTCTCAGTTCCTCAG -3'
(R):5'- GAGAAGCCACAGGATTGACC -3'

Sequencing Primer
(F):5'- CAGTTCCTCAGTCTTTGAAATATGG -3'
(R):5'- GACTCTAAGTCTTCTTTACCATGAAC -3'
Posted On2018-07-23