Incidental Mutation 'R6682:Olfr370'
ID 527544
Institutional Source Beutler Lab
Gene Symbol Olfr370
Ensembl Gene ENSMUSG00000047286
Gene Name olfactory receptor 370
Synonyms GA_x6K02T2NUPS-11609807-11610751, MOR267-16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 83535780-83545227 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83541558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 138 (H138R)
Ref Sequence ENSEMBL: ENSMUSP00000149251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058609] [ENSMUST00000209408] [ENSMUST00000214156]
AlphaFold E9Q848
Predicted Effect probably benign
Transcript: ENSMUST00000058609
AA Change: H138R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055435
Gene: ENSMUSG00000047286
AA Change: H138R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-44 PFAM
Pfam:7tm_1 41 290 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209408
AA Change: H138R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212153
Predicted Effect probably benign
Transcript: ENSMUST00000214156
AA Change: H138R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Olfr370
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr370 APN 8 83541618 missense probably benign 0.00
IGL02481:Olfr370 APN 8 83541386 missense possibly damaging 0.70
IGL02499:Olfr370 APN 8 83541183 missense possibly damaging 0.83
IGL02832:Olfr370 APN 8 83541471 missense probably damaging 1.00
R0315:Olfr370 UTSW 8 83541372 missense possibly damaging 0.90
R0330:Olfr370 UTSW 8 83541513 missense probably damaging 1.00
R1737:Olfr370 UTSW 8 83541416 missense probably benign 0.05
R1973:Olfr370 UTSW 8 83541792 missense probably benign 0.00
R2157:Olfr370 UTSW 8 83541621 missense probably benign 0.00
R4687:Olfr370 UTSW 8 83541860 missense probably damaging 1.00
R5639:Olfr370 UTSW 8 83541344 missense probably damaging 1.00
R6150:Olfr370 UTSW 8 83541153 missense probably benign 0.02
R6590:Olfr370 UTSW 8 83541275 missense probably benign 0.08
R6690:Olfr370 UTSW 8 83541275 missense probably benign 0.08
R7846:Olfr370 UTSW 8 83541897 missense probably damaging 1.00
R7886:Olfr370 UTSW 8 83541947 missense possibly damaging 0.95
R8349:Olfr370 UTSW 8 83541672 missense probably damaging 1.00
R8361:Olfr370 UTSW 8 83542086 missense possibly damaging 0.86
R8449:Olfr370 UTSW 8 83541672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTGCCCAAGATGCTGG -3'
(R):5'- AAAACGCTTTGTACCTGCCC -3'

Sequencing Primer
(F):5'- CCCAAGATGCTGGTTGACTTGC -3'
(R):5'- TTGTACCTGCCCAGCGTG -3'
Posted On 2018-07-23