Incidental Mutation 'R6682:Bcl9l'
ID527547
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44501103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000151342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074989] [ENSMUST00000218183] [ENSMUST00000218913] [ENSMUST00000220303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074989
AA Change: T129A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: T129A

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217898
Predicted Effect possibly damaging
Transcript: ENSMUST00000218183
AA Change: T129A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000218913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220292
Predicted Effect possibly damaging
Transcript: ENSMUST00000220303
AA Change: T92A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 unclassified probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0227:Bcl9l UTSW 9 44505236 missense possibly damaging 0.96
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1971:Bcl9l UTSW 9 44508699 unclassified probably null
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5572:Bcl9l UTSW 9 44500798 missense possibly damaging 0.66
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
R7171:Bcl9l UTSW 9 44505151 missense probably benign 0.33
R7338:Bcl9l UTSW 9 44508708 missense probably benign
R7448:Bcl9l UTSW 9 44509337 missense probably benign 0.00
R7609:Bcl9l UTSW 9 44505747 missense probably damaging 0.99
R7793:Bcl9l UTSW 9 44508966 missense probably benign 0.00
R7793:Bcl9l UTSW 9 44509697 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACCAGAATGTGAACCAAG -3'
(R):5'- AACTGGTTGACTGATGGGTAGAC -3'

Sequencing Primer
(F):5'- TGCAACCTGGGCTCCAAG -3'
(R):5'- TTGACTGATGGGTAGACGTAAGAG -3'
Posted On2018-07-23