Incidental Mutation 'R6682:Pth1r'
ID 527548
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6682 (G1)
Quality Score 122.008
Status Not validated
Chromosome 9
Chromosomal Location 110722085-110747145 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 110727251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect probably null
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R2206:Pth1r UTSW 9 110723587 missense probably damaging 1.00
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4590:Pth1r UTSW 9 110722271 missense probably benign 0.04
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6914:Pth1r UTSW 9 110728016 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R8966:Pth1r UTSW 9 110725161 missense possibly damaging 0.79
R9168:Pth1r UTSW 9 110727136 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TAGAGCACAGCGTCCTTCAC -3'
(R):5'- GGGATATTCCATGTCTCTTGCC -3'

Sequencing Primer
(F):5'- GTCCTTCACGAAGATGCTCG -3'
(R):5'- CGTGGCTGTGCTCATCCTAG -3'
Posted On 2018-07-23