Incidental Mutation 'R6682:Ldb3'
ID 527554
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene Name LIM domain binding 3
Synonyms cypher, ZASP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34526603-34588682 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34552264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 334 (T334S)
Ref Sequence ENSEMBL: ENSMUSP00000066784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000228044]
AlphaFold Q9JKS4
Predicted Effect possibly damaging
Transcript: ENSMUST00000022327
AA Change: T378S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798
AA Change: T378S

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022328
AA Change: T316S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798
AA Change: T316S

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064098
AA Change: T334S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798
AA Change: T334S

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090040
AA Change: T339S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798
AA Change: T339S

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228044
AA Change: T277S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R2865:Ldb3 UTSW 14 34529503 missense probably damaging 1.00
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3765:Ldb3 UTSW 14 34578682 splice site probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R4963:Ldb3 UTSW 14 34566858 missense probably damaging 0.98
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6549:Ldb3 UTSW 14 34541897 missense probably damaging 0.99
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7132:Ldb3 UTSW 14 34577035 missense probably benign 0.25
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
R7488:Ldb3 UTSW 14 34567445 missense probably damaging 1.00
R7760:Ldb3 UTSW 14 34542503 missense probably damaging 1.00
R8755:Ldb3 UTSW 14 34577299 missense probably damaging 1.00
R8845:Ldb3 UTSW 14 34536677 missense probably damaging 1.00
R8954:Ldb3 UTSW 14 34555344 missense probably null 0.17
R9179:Ldb3 UTSW 14 34555355 missense probably benign
R9321:Ldb3 UTSW 14 34544142 nonsense probably null
R9702:Ldb3 UTSW 14 34577133 missense probably benign 0.03
Z1176:Ldb3 UTSW 14 34555365 missense probably benign 0.21
Z1177:Ldb3 UTSW 14 34544103 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCTCAGTCGGATTCTGC -3'
(R):5'- TAGACTCTGGAAGTGACCCAATG -3'

Sequencing Primer
(F):5'- GGATTCTGCCCTACAACCAGGAG -3'
(R):5'- CCCAATGGGTGTTTCTGTCATAGTC -3'
Posted On 2018-07-23