Incidental Mutation 'R6682:Vmn2r95'
ID 527556
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Name vomeronasal 2, receptor 95
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18424078-18460905 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 18440227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 300 (N300K)
Ref Sequence ENSEMBL: ENSMUSP00000156117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
AlphaFold A0A338P6T0
Predicted Effect probably damaging
Transcript: ENSMUST00000166327
AA Change: N300K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: N300K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232090
AA Change: N300K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232464
AA Change: N300K

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18439973 missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18451653 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18440075 missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18440090 missense probably benign
R7755:Vmn2r95 UTSW 17 18424105 start codon destroyed probably null 0.99
R7942:Vmn2r95 UTSW 17 18440267 missense possibly damaging 0.74
R8355:Vmn2r95 UTSW 17 18440090 missense probably benign
R8455:Vmn2r95 UTSW 17 18440090 missense probably benign
R8478:Vmn2r95 UTSW 17 18452282 missense probably damaging 1.00
R8547:Vmn2r95 UTSW 17 18443899 missense probably damaging 1.00
R8752:Vmn2r95 UTSW 17 18441476 missense probably damaging 0.98
R8788:Vmn2r95 UTSW 17 18451528 missense probably benign 0.09
R8852:Vmn2r95 UTSW 17 18443851 missense possibly damaging 0.95
R9098:Vmn2r95 UTSW 17 18439905 missense possibly damaging 0.88
R9202:Vmn2r95 UTSW 17 18424132 missense probably benign 0.00
R9244:Vmn2r95 UTSW 17 18451927 missense possibly damaging 0.91
R9546:Vmn2r95 UTSW 17 18441459 missense probably benign 0.01
R9665:Vmn2r95 UTSW 17 18440345 missense probably damaging 0.99
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATGGGTTGGTCTCATCC -3'
(R):5'- TGAAGAACAAATACCACAGCTTAGG -3'

Sequencing Primer
(F):5'- GAGAAAAGATATCTGCCTAGCTTTTG -3'
(R):5'- TCTCCCTATAATGGTGCTT -3'
Posted On 2018-07-23