Incidental Mutation 'R6682:Vmn2r95'
ID 527556
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Name vomeronasal 2, receptor 95
Synonyms
MMRRC Submission 044801-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18644366-18672586 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 18660489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 300 (N300K)
Ref Sequence ENSEMBL: ENSMUSP00000156117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
AlphaFold A0A338P6T0
Predicted Effect probably damaging
Transcript: ENSMUST00000166327
AA Change: N300K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: N300K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232090
AA Change: N300K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232464
AA Change: N300K

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,385,460 (GRCm39) V368A possibly damaging Het
Bcl9l A G 9: 44,412,400 (GRCm39) T92A possibly damaging Het
Celsr2 A T 3: 108,307,817 (GRCm39) probably null Het
Cndp2 T C 18: 84,695,455 (GRCm39) K149E probably benign Het
Cnpy4 T C 5: 138,185,984 (GRCm39) probably null Het
Cox6c A T 15: 35,938,319 (GRCm39) probably null Het
Cpt2 G T 4: 107,761,627 (GRCm39) S158R probably damaging Het
Dlgap1 A G 17: 71,094,118 (GRCm39) K813R probably damaging Het
Dock10 A C 1: 80,490,338 (GRCm39) L1927R probably damaging Het
Gak T A 5: 108,746,742 (GRCm39) K430I probably damaging Het
Grik3 T A 4: 125,544,259 (GRCm39) Y327N probably damaging Het
Ldb3 T A 14: 34,274,221 (GRCm39) T334S possibly damaging Het
Ldlr A G 9: 21,643,671 (GRCm39) D85G probably benign Het
Med26 T A 8: 73,249,927 (GRCm39) T391S probably benign Het
Mmp27 A G 9: 7,573,606 (GRCm39) T233A probably benign Het
Mob1a A G 6: 83,311,132 (GRCm39) Y117C possibly damaging Het
Mrps35 A T 6: 146,949,777 (GRCm39) E97V possibly damaging Het
Msln A T 17: 25,971,993 (GRCm39) S75T probably damaging Het
Myoz1 C T 14: 20,703,687 (GRCm39) probably null Het
Nim1k A G 13: 120,173,724 (GRCm39) I390T probably benign Het
Or10k2 A G 8: 84,268,187 (GRCm39) H138R probably benign Het
Or4k51 C T 2: 111,584,980 (GRCm39) P129S probably damaging Het
Pclo A C 5: 14,589,893 (GRCm39) Q731P unknown Het
Prl3d3 G A 13: 27,345,023 (GRCm39) E132K probably benign Het
Pth1r C T 9: 110,556,319 (GRCm39) probably null Het
Ptpru T C 4: 131,548,093 (GRCm39) M135V probably benign Het
Slc12a9 A T 5: 137,325,663 (GRCm39) L316Q probably damaging Het
Slc35f6 G A 5: 30,814,764 (GRCm39) M177I possibly damaging Het
Smc4 T A 3: 68,914,574 (GRCm39) S62R probably damaging Het
Tmem179 C T 12: 112,469,714 (GRCm39) D29N probably benign Het
Togaram2 A T 17: 72,011,749 (GRCm39) D476V probably benign Het
Trpc4ap C T 2: 155,479,687 (GRCm39) probably null Het
Trpm8 C A 1: 88,254,224 (GRCm39) T149K probably damaging Het
Uhmk1 C T 1: 170,039,804 (GRCm39) probably null Het
Vmn2r79 C A 7: 86,653,370 (GRCm39) T545K possibly damaging Het
Wdr41 G A 13: 95,149,639 (GRCm39) G419D probably damaging Het
Zc3hav1 A T 6: 38,302,130 (GRCm39) H597Q probably benign Het
Zfp704 T C 3: 9,630,253 (GRCm39) E36G probably benign Het
Zfp9 A G 6: 118,444,202 (GRCm39) V47A possibly damaging Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18,672,590 (GRCm39) utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18,664,124 (GRCm39) missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18,671,737 (GRCm39) missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18,660,473 (GRCm39) missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18,660,169 (GRCm39) missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18,672,248 (GRCm39) missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18,672,038 (GRCm39) missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18,660,218 (GRCm39) missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18,671,994 (GRCm39) missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18,664,116 (GRCm39) missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18,672,120 (GRCm39) missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18,672,298 (GRCm39) nonsense probably null
IGL03032:Vmn2r95 APN 17 18,672,575 (GRCm39) missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18,661,664 (GRCm39) missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18,672,005 (GRCm39) missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18,671,844 (GRCm39) missense probably benign
R0519:Vmn2r95 UTSW 17 18,659,765 (GRCm39) missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18,672,362 (GRCm39) missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18,660,118 (GRCm39) missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18,672,575 (GRCm39) missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18,660,901 (GRCm39) splice site probably benign
R1861:Vmn2r95 UTSW 17 18,672,530 (GRCm39) missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18,644,575 (GRCm39) missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18,671,805 (GRCm39) missense probably benign
R2031:Vmn2r95 UTSW 17 18,659,717 (GRCm39) missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18,661,561 (GRCm39) missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18,660,235 (GRCm39) missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18,661,744 (GRCm39) nonsense probably null
R3953:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18,660,358 (GRCm39) missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18,672,507 (GRCm39) missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18,672,413 (GRCm39) missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18,671,915 (GRCm39) missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18,671,708 (GRCm39) missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18,660,337 (GRCm39) missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18,661,624 (GRCm39) missense probably benign
R6183:Vmn2r95 UTSW 17 18,664,192 (GRCm39) missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18,671,732 (GRCm39) missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18,660,622 (GRCm39) missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18,672,551 (GRCm39) utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18,659,555 (GRCm39) missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18,664,182 (GRCm39) missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18,664,181 (GRCm39) missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18,672,323 (GRCm39) missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18,661,577 (GRCm39) missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18,672,245 (GRCm39) missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18,672,225 (GRCm39) missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18,660,734 (GRCm39) missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R7755:Vmn2r95 UTSW 17 18,644,367 (GRCm39) start codon destroyed probably null 0.99
R7942:Vmn2r95 UTSW 17 18,660,529 (GRCm39) missense possibly damaging 0.74
R8355:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R8455:Vmn2r95 UTSW 17 18,660,352 (GRCm39) missense probably benign
R8478:Vmn2r95 UTSW 17 18,672,544 (GRCm39) missense probably damaging 1.00
R8547:Vmn2r95 UTSW 17 18,664,161 (GRCm39) missense probably damaging 1.00
R8752:Vmn2r95 UTSW 17 18,661,738 (GRCm39) missense probably damaging 0.98
R8788:Vmn2r95 UTSW 17 18,671,790 (GRCm39) missense probably benign 0.09
R8852:Vmn2r95 UTSW 17 18,664,113 (GRCm39) missense possibly damaging 0.95
R9098:Vmn2r95 UTSW 17 18,660,167 (GRCm39) missense possibly damaging 0.88
R9202:Vmn2r95 UTSW 17 18,644,394 (GRCm39) missense probably benign 0.00
R9244:Vmn2r95 UTSW 17 18,672,189 (GRCm39) missense possibly damaging 0.91
R9546:Vmn2r95 UTSW 17 18,661,721 (GRCm39) missense probably benign 0.01
R9665:Vmn2r95 UTSW 17 18,660,607 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r95 UTSW 17 18,660,663 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATGGGTTGGTCTCATCC -3'
(R):5'- TGAAGAACAAATACCACAGCTTAGG -3'

Sequencing Primer
(F):5'- GAGAAAAGATATCTGCCTAGCTTTTG -3'
(R):5'- TCTCCCTATAATGGTGCTT -3'
Posted On 2018-07-23