Incidental Mutation 'R6682:Msln'
ID 527557
Institutional Source Beutler Lab
Gene Symbol Msln
Ensembl Gene ENSMUSG00000063011
Gene Name mesothelin
Synonyms MPF, megakaryocyte potentiating factor
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25748614-25754327 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25753019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 75 (S75T)
Ref Sequence ENSEMBL: ENSMUSP00000075279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
AlphaFold Q61468
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075884
AA Change: S75T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011
AA Change: S75T

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate two protein products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiating factor functions as a cytokine that can stimulate colony formation of bone marrow megakaryocytes. Mesothelin is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this allele display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Msln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Msln APN 17 25750030 critical splice donor site probably null
IGL02986:Msln APN 17 25752933 splice site probably benign
R0349:Msln UTSW 17 25750276 missense possibly damaging 0.69
R0562:Msln UTSW 17 25753006 missense probably benign 0.16
R0845:Msln UTSW 17 25750796 missense probably damaging 1.00
R1256:Msln UTSW 17 25754183 missense probably damaging 1.00
R1305:Msln UTSW 17 25753027 missense probably benign 0.00
R1651:Msln UTSW 17 25753408 missense probably benign 0.00
R1930:Msln UTSW 17 25751922 missense probably damaging 0.99
R1996:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R4532:Msln UTSW 17 25750724 missense probably damaging 0.98
R5004:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R5157:Msln UTSW 17 25752983 missense probably benign 0.01
R5159:Msln UTSW 17 25751589 missense probably benign 0.01
R5510:Msln UTSW 17 25749873 missense probably benign 0.15
R6385:Msln UTSW 17 25751141 missense probably benign 0.19
R6650:Msln UTSW 17 25750170 missense probably benign 0.00
R7091:Msln UTSW 17 25750080 missense probably damaging 1.00
R7472:Msln UTSW 17 25750734 missense possibly damaging 0.95
R8085:Msln UTSW 17 25752968 nonsense probably null
R8289:Msln UTSW 17 25748906 missense possibly damaging 0.50
R9137:Msln UTSW 17 25750110 missense probably benign 0.24
R9217:Msln UTSW 17 25751151 missense probably benign 0.02
R9309:Msln UTSW 17 25751174 missense possibly damaging 0.68
R9311:Msln UTSW 17 25753016 missense probably benign 0.09
R9441:Msln UTSW 17 25750757 missense probably benign 0.02
R9652:Msln UTSW 17 25749068 missense probably damaging 1.00
R9723:Msln UTSW 17 25750034 missense possibly damaging 0.55
R9798:Msln UTSW 17 25753797 missense probably benign 0.01
X0002:Msln UTSW 17 25752310 splice site probably null
Z1176:Msln UTSW 17 25753794 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTCAGTTAGGCAGCAAGAGG -3'
(R):5'- GGTTGTCACTTGTCCCAAAGAG -3'

Sequencing Primer
(F):5'- CAGACCCTGAGTTGGCATGAG -3'
(R):5'- GGGTCATGAGAAGCCCAG -3'
Posted On 2018-07-23