Incidental Mutation 'R6682:Togaram2'
ID527559
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6682 (G1)
Quality Score214.009
Status Not validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71704754 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 476 (D476V)
Ref Sequence ENSEMBL: ENSMUSP00000122691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
AA Change: D476V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: D476V

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144479
AA Change: D477V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: D477V

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
AA Change: D476V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: D476V

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4066:Togaram2 UTSW 17 71716238 intron probably benign
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71689209 missense probably benign 0.00
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7015:Togaram2 UTSW 17 71709568 missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
R7383:Togaram2 UTSW 17 71700517 missense probably damaging 1.00
R7691:Togaram2 UTSW 17 71716410 missense probably benign 0.16
R7778:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7824:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7862:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7864:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
R7945:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7947:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 71701002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTGGCACCGGAATGAATAG -3'
(R):5'- GGACATCTTCTGTAGCCCTC -3'

Sequencing Primer
(F):5'- GCCAGGCTCTTCAGTGTCTG -3'
(R):5'- TGTAGCCCTCCTAAATATCACCC -3'
Posted On2018-07-23