Incidental Mutation 'R6683:Nck2'
ID 527561
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Name non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms 4833426I10Rik, Grb4, NCKbeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 43444579-43570515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43569178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421]
AlphaFold O55033
Predicted Effect probably benign
Transcript: ENSMUST00000086421
AA Change: S327P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: S327P

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114744
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
wake UTSW 1 43554260 missense probably benign
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R1080:Nck2 UTSW 1 43533581 missense probably benign 0.00
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4029:Nck2 UTSW 1 43554091 missense probably benign
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6859:Nck2 UTSW 1 43554351 missense probably benign 0.24
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
R8278:Nck2 UTSW 1 43554580 missense probably damaging 1.00
R9004:Nck2 UTSW 1 43554350 missense
R9063:Nck2 UTSW 1 43554343 missense possibly damaging 0.91
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACGAGATCCTCCGTGTCAGAG -3'
(R):5'- CTGCTTTCACTGTAGGGCTC -3'

Sequencing Primer
(F):5'- CCATGGAAGCAGAATTTCATTAGCG -3'
(R):5'- TCGGACAAGGTAGAGCTTCTC -3'
Posted On 2018-07-23