Incidental Mutation 'R6683:Aamp'
ID 527562
Institutional Source Beutler Lab
Gene Symbol Aamp
Ensembl Gene ENSMUSG00000006299
Gene Name angio-associated migratory protein
Synonyms Aamp-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74279840-74284738 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74282445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 169 (E169G)
Ref Sequence ENSEMBL: ENSMUSP00000136644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000027370] [ENSMUST00000077985] [ENSMUST00000087226] [ENSMUST00000113805] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
AlphaFold J3QN89
Predicted Effect possibly damaging
Transcript: ENSMUST00000006462
AA Change: E168G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299
AA Change: E168G

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077985
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113805
SMART Domains Protein: ENSMUSP00000109436
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 4e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152492
Predicted Effect possibly damaging
Transcript: ENSMUST00000178235
AA Change: E169G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299
AA Change: E169G

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186833
Predicted Effect probably benign
Transcript: ENSMUST00000187046
AA Change: E107G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299
AA Change: E107G

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187908
Predicted Effect probably benign
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191258
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Aamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Aamp APN 1 74281436 unclassified probably benign
IGL02476:Aamp APN 1 74281524 unclassified probably benign
R0960:Aamp UTSW 1 74281145 missense possibly damaging 0.77
R1590:Aamp UTSW 1 74283211 missense probably damaging 1.00
R2138:Aamp UTSW 1 74283963 missense probably benign 0.00
R4112:Aamp UTSW 1 74281227 unclassified probably benign
R4223:Aamp UTSW 1 74281126 missense probably damaging 0.98
R5049:Aamp UTSW 1 74282539 missense probably damaging 1.00
R5283:Aamp UTSW 1 74284006 missense possibly damaging 0.49
R6353:Aamp UTSW 1 74280828 missense probably benign 0.37
R6526:Aamp UTSW 1 74284172 critical splice donor site probably null
R6884:Aamp UTSW 1 74284248 unclassified probably benign
R7141:Aamp UTSW 1 74284111 splice site probably null
R9139:Aamp UTSW 1 74281546 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TACCTAAGTCCATGAGCCTCATC -3'
(R):5'- TGGCCTCAAACTTGGTACATC -3'

Sequencing Primer
(F):5'- CATGAGCCTCATCTAAGGTGTGAC -3'
(R):5'- GGTACATCTCTTAGGCAAACTTGAG -3'
Posted On 2018-07-23