Incidental Mutation 'R6683:St8sia4'
ID 527563
Institutional Source Beutler Lab
Gene Symbol St8sia4
Ensembl Gene ENSMUSG00000040710
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms ST8SiaIV, PST, Siat8d, PST-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 95587682-95667571 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95653699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Ref Sequence ENSEMBL: ENSMUSP00000140534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043336] [ENSMUST00000189556]
AlphaFold Q64692
Predicted Effect probably damaging
Transcript: ENSMUST00000043336
AA Change: D106G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043477
Gene: ENSMUSG00000040710
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_transf_29 94 354 2.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187936
Predicted Effect probably damaging
Transcript: ENSMUST00000189556
AA Change: D106G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140534
Gene: ENSMUSG00000040710
AA Change: D106G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Glyco_transf_29 90 266 2.2e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null adult mice exhibit impaired long term potentiation and impaired long term depression in hippocampal CA1 synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in St8sia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:St8sia4 APN 1 95653757 missense probably benign 0.19
IGL02109:St8sia4 APN 1 95660892 missense possibly damaging 0.68
IGL03117:St8sia4 APN 1 95591783 missense probably benign 0.12
IGL03280:St8sia4 APN 1 95653774 splice site probably benign
IGL03328:St8sia4 APN 1 95660870 missense probably benign 0.01
R0336:St8sia4 UTSW 1 95653558 missense probably benign 0.36
R0433:St8sia4 UTSW 1 95591704 missense probably damaging 0.97
R1217:St8sia4 UTSW 1 95653739 missense probably damaging 1.00
R1721:St8sia4 UTSW 1 95653669 missense probably damaging 0.99
R1752:St8sia4 UTSW 1 95591812 missense probably benign 0.32
R1891:St8sia4 UTSW 1 95591708 missense possibly damaging 0.93
R1909:St8sia4 UTSW 1 95627573 missense probably damaging 1.00
R2098:St8sia4 UTSW 1 95653528 missense probably damaging 1.00
R2322:St8sia4 UTSW 1 95653738 missense probably damaging 1.00
R4094:St8sia4 UTSW 1 95627686 missense possibly damaging 0.53
R4365:St8sia4 UTSW 1 95591792 missense possibly damaging 0.89
R4852:St8sia4 UTSW 1 95660898 missense probably damaging 1.00
R4988:St8sia4 UTSW 1 95591797 missense possibly damaging 0.95
R5074:St8sia4 UTSW 1 95667185 missense probably benign 0.29
R5220:St8sia4 UTSW 1 95627735 missense probably damaging 0.97
R5611:St8sia4 UTSW 1 95627684 missense probably damaging 0.96
R5970:St8sia4 UTSW 1 95653582 missense probably damaging 1.00
R6027:St8sia4 UTSW 1 95653674 missense probably damaging 1.00
R7498:St8sia4 UTSW 1 95591693 missense probably benign
R7937:St8sia4 UTSW 1 95653595 missense possibly damaging 0.56
R8775:St8sia4 UTSW 1 95591747 missense possibly damaging 0.93
R8775-TAIL:St8sia4 UTSW 1 95591747 missense possibly damaging 0.93
R9095:St8sia4 UTSW 1 95591800 missense probably damaging 0.99
R9252:St8sia4 UTSW 1 95627507 frame shift probably null
R9433:St8sia4 UTSW 1 95627639 missense
X0063:St8sia4 UTSW 1 95591923 missense possibly damaging 0.92
Z1177:St8sia4 UTSW 1 95667456 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAAGAACAGCAGGATGC -3'
(R):5'- CCAGCTGACAATTTAAGAGCAG -3'

Sequencing Primer
(F):5'- GCAGGATGCTCACCTTATTACAAAG -3'
(R):5'- GCTGACAATTTAAGAGCAGTAGTTG -3'
Posted On 2018-07-23