Incidental Mutation 'R6683:Plcb1'
ID 527566
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
MMRRC Submission 044802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R6683 (G1)
Quality Score 206.009
Status Not validated
Chromosome 2
Chromosomal Location 134628084-135317178 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134628513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 21 (S21C)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: S21C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: S21C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: S21C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: S21C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130524
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: S21C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: S21C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202531
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,321,604 (GRCm39) E169G possibly damaging Het
Acat2 G A 17: 13,162,814 (GRCm39) R377C probably benign Het
Adgrg6 A G 10: 14,331,911 (GRCm39) V398A probably damaging Het
BC025920 A G 10: 81,445,135 (GRCm39) H86R probably damaging Het
BC028528 T C 3: 95,795,539 (GRCm39) T88A probably damaging Het
Creb3l4 T A 3: 90,145,112 (GRCm39) T347S probably benign Het
Dhcr7 T C 7: 143,397,048 (GRCm39) V180A probably damaging Het
Fam187a T C 11: 102,777,015 (GRCm39) V273A probably damaging Het
Hdgfl3 G A 7: 81,550,101 (GRCm39) R78W possibly damaging Het
Krt8 T C 15: 101,906,439 (GRCm39) T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,339,354 (GRCm39) probably benign Het
Ly6d A T 15: 74,634,299 (GRCm39) V97D probably benign Het
Map3k13 T C 16: 21,711,062 (GRCm39) I115T probably benign Het
Muc2 G A 7: 141,305,214 (GRCm39) V173I probably benign Het
Nck2 T C 1: 43,608,338 (GRCm39) S327P probably benign Het
Ncoa7 T C 10: 30,647,717 (GRCm39) R20G probably damaging Het
Nlrp4f G A 13: 65,347,009 (GRCm39) T83I probably benign Het
Nploc4 A G 11: 120,274,156 (GRCm39) S546P probably damaging Het
Or1e1d-ps1 A G 11: 73,818,939 (GRCm39) Y36C probably damaging Het
Or51g2 C T 7: 102,622,920 (GRCm39) R93Q probably benign Het
Or52e8 C T 7: 104,625,175 (GRCm39) V10I probably benign Het
Or5b21 A G 19: 12,840,014 (GRCm39) S292G probably damaging Het
Panx1 T C 9: 14,919,307 (GRCm39) E184G probably benign Het
Parp14 T C 16: 35,655,047 (GRCm39) Y1808C probably damaging Het
Ppil6 A G 10: 41,374,427 (GRCm39) N103D probably benign Het
Pth1r C T 9: 110,556,319 (GRCm39) probably null Het
Rapgef4 A T 2: 71,885,123 (GRCm39) probably benign Het
Rlf A G 4: 121,005,123 (GRCm39) S1286P probably damaging Het
Rnf217 A G 10: 31,410,822 (GRCm39) V291A possibly damaging Het
Serpina3a T C 12: 104,085,896 (GRCm39) M117T probably benign Het
St8sia4 T C 1: 95,581,424 (GRCm39) D106G probably damaging Het
Tjp2 A G 19: 24,098,207 (GRCm39) I485T probably damaging Het
Trdc T C 14: 54,381,692 (GRCm39) probably benign Het
Ttn A G 2: 76,541,004 (GRCm39) L33994P probably damaging Het
Vmn2r42 T A 7: 8,187,224 (GRCm39) K799N probably damaging Het
Zfp42 G A 8: 43,749,093 (GRCm39) T136M possibly damaging Het
Znhit1 A T 5: 137,011,487 (GRCm39) S109T probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,093,676 (GRCm39) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,655,579 (GRCm39) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,062,711 (GRCm39) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,188,238 (GRCm39) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,628,479 (GRCm39) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,229,773 (GRCm39) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,229,091 (GRCm39) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,314,183 (GRCm39) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,136,784 (GRCm39) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,062,779 (GRCm39) splice site probably benign
IGL02926:Plcb1 APN 2 135,206,682 (GRCm39) splice site probably benign
IGL03071:Plcb1 APN 2 135,229,722 (GRCm39) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,188,226 (GRCm39) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,212,348 (GRCm39) missense probably benign
IGL03387:Plcb1 APN 2 134,655,606 (GRCm39) splice site probably benign
BB001:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
BB011:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0308:Plcb1 UTSW 2 134,655,534 (GRCm39) missense probably benign 0.01
R0415:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,136,831 (GRCm39) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,229,063 (GRCm39) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,167,577 (GRCm39) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,204,364 (GRCm39) splice site probably benign
R1617:Plcb1 UTSW 2 135,179,361 (GRCm39) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R1866:Plcb1 UTSW 2 135,186,093 (GRCm39) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,152,934 (GRCm39) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,655,533 (GRCm39) missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135,228,222 (GRCm39) missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2132:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2133:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2164:Plcb1 UTSW 2 135,188,250 (GRCm39) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,104,020 (GRCm39) splice site probably benign
R2429:Plcb1 UTSW 2 135,179,362 (GRCm39) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,102,428 (GRCm39) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,177,402 (GRCm39) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,167,591 (GRCm39) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,187,010 (GRCm39) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,186,078 (GRCm39) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,093,667 (GRCm39) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,187,015 (GRCm39) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,175,320 (GRCm39) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,104,165 (GRCm39) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,094,696 (GRCm39) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,189,322 (GRCm39) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,102,486 (GRCm39) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,212,513 (GRCm39) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,177,400 (GRCm39) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,104,164 (GRCm39) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,212,486 (GRCm39) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,188,261 (GRCm39) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,177,371 (GRCm39) missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135,167,722 (GRCm39) critical splice donor site probably null
R6760:Plcb1 UTSW 2 135,313,980 (GRCm39) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,228,075 (GRCm39) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,104,159 (GRCm39) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,212,430 (GRCm39) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,186,196 (GRCm39) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,093,684 (GRCm39) nonsense probably null
R7498:Plcb1 UTSW 2 135,104,154 (GRCm39) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,104,153 (GRCm39) nonsense probably null
R7777:Plcb1 UTSW 2 135,062,677 (GRCm39) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,188,316 (GRCm39) missense probably benign
R8099:Plcb1 UTSW 2 135,093,654 (GRCm39) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,177,396 (GRCm39) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,159,710 (GRCm39) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,091,972 (GRCm39) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,206,853 (GRCm39) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,094,696 (GRCm39) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,177,369 (GRCm39) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,175,429 (GRCm39) intron probably benign
R8950:Plcb1 UTSW 2 135,179,439 (GRCm39) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,182,615 (GRCm39) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,167,610 (GRCm39) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,189,385 (GRCm39) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,164,558 (GRCm39) missense probably benign 0.03
S24628:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135,186,974 (GRCm39) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,062,766 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTCGTCCCGCTTACTAAG -3'
(R):5'- TTAAGTCCCTCAGGAGGTGC -3'

Sequencing Primer
(F):5'- TTACTAAGCGGCGCGGG -3'
(R):5'- CTCTAAACCCCCTAGGAGGAGGAG -3'
Posted On 2018-07-23