Incidental Mutation 'R6683:Lkaaear1'
ID 527567
Institutional Source Beutler Lab
Gene Symbol Lkaaear1
Ensembl Gene ENSMUSG00000045794
Gene Name LKAAEAR motif containing 1 (IKAAEAR murine motif)
Synonyms LOC277496, 4930526D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R6683 (G1)
Quality Score 217.468
Status Not validated
Chromosome 2
Chromosomal Location 181696793-181698442 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG to TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG at 181697561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000052416] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108779]
AlphaFold Q8BIG2
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052416
SMART Domains Protein: ENSMUSP00000061134
Gene: ENSMUSG00000045794

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:LKAAEAR 44 179 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect probably benign
Transcript: ENSMUST00000132409
SMART Domains Protein: ENSMUSP00000116083
Gene: ENSMUSG00000045794

DomainStartEndE-ValueType
Pfam:LKAAEAR 1 91 7.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Lkaaear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lkaaear1 APN 2 181697334 missense probably benign 0.00
IGL01508:Lkaaear1 APN 2 181697037 missense probably benign 0.09
FR4304:Lkaaear1 UTSW 2 181697579 unclassified probably benign
FR4340:Lkaaear1 UTSW 2 181697594 unclassified probably benign
FR4449:Lkaaear1 UTSW 2 181697571 unclassified probably benign
R3430:Lkaaear1 UTSW 2 181697531 missense probably benign 0.02
R4994:Lkaaear1 UTSW 2 181697583 nonsense probably null
R6684:Lkaaear1 UTSW 2 181697561 unclassified probably benign
R6685:Lkaaear1 UTSW 2 181697561 unclassified probably benign
RF007:Lkaaear1 UTSW 2 181697559 unclassified probably benign
RF007:Lkaaear1 UTSW 2 181697577 unclassified probably benign
RF022:Lkaaear1 UTSW 2 181697577 unclassified probably benign
RF029:Lkaaear1 UTSW 2 181697579 unclassified probably benign
RF029:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF033:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF036:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF049:Lkaaear1 UTSW 2 181697574 unclassified probably benign
RF052:Lkaaear1 UTSW 2 181697433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCGTAGGGTAACTCCACCG -3'
(R):5'- GATATGCACAGGGTCAGCTAC -3'

Sequencing Primer
(F):5'- TAGGGTAACTCCACCGACTCG -3'
(R):5'- TTAGGTGGCTACAGGAAGTCCC -3'
Posted On 2018-07-23