Incidental Mutation 'R6683:Creb3l4'
ID527568
Institutional Source Beutler Lab
Gene Symbol Creb3l4
Ensembl Gene ENSMUSG00000027938
Gene NamecAMP responsive element binding protein 3-like 4
SynonymsTisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R6683 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90237500-90243512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90237805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 347 (T347S)
Ref Sequence ENSEMBL: ENSMUSP00000102992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000119304]
Predicted Effect probably benign
Transcript: ENSMUST00000029546
SMART Domains Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:JTB 37 143 5.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029547
AA Change: T347S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: T347S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107369
AA Change: T347S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: T347S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119304
SMART Domains Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:JTB 30 95 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157045
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Creb3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Creb3l4 APN 3 90241987 missense possibly damaging 0.95
IGL01015:Creb3l4 APN 3 90242831 start codon destroyed probably null
IGL01092:Creb3l4 APN 3 90237738 missense probably damaging 1.00
IGL02172:Creb3l4 APN 3 90242775 missense probably benign 0.21
IGL02291:Creb3l4 APN 3 90241983 missense probably benign 0.03
R1344:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1418:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1836:Creb3l4 UTSW 3 90238903 missense probably benign 0.26
R2154:Creb3l4 UTSW 3 90238485 missense probably damaging 1.00
R2877:Creb3l4 UTSW 3 90242308 missense probably damaging 0.99
R4923:Creb3l4 UTSW 3 90242214 missense probably benign 0.00
R6024:Creb3l4 UTSW 3 90238699 missense probably damaging 1.00
R7567:Creb3l4 UTSW 3 90242422 missense probably benign 0.00
Z1088:Creb3l4 UTSW 3 90237751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCTTTGACCTTACCACAAAG -3'
(R):5'- AGGATGAGCCACGAAACAATTCTC -3'

Sequencing Primer
(F):5'- TTGACCTTACCACAAAGAAGAAATG -3'
(R):5'- CAAGTAGGAGTTCTGGGCCAGTC -3'
Posted On2018-07-23