Mutagenetix > Incidental Mutations

Incidental Mutation 'R6683:Creb3l4'

527568

Institutional Source

Beutler Lab

Gene Symbol

Creb3l4

Ensembl Gene

ENSMUSG00000027938

Gene Name

cAMP responsive element binding protein 3-like 4

Synonyms

Tisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R6683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90237500-90243512 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90237805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 347 (T347S)

Ref Sequence

ENSEMBL: ENSMUSP00000102992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000119304]

AlphaFold

Q9D2A5

Predicted Effect

probably benign
Transcript: ENSMUST00000029546

SMART Domains

Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:JTB	37	143	5.6e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000029547
AA Change: T347S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: T347S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
BRLZ	191	255	1.49e-13	SMART
low complexity region	275	291	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107369
AA Change: T347S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: T347S

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
BRLZ	191	255	1.49e-13	SMART
low complexity region	275	291	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119304

SMART Domains

Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
Pfam:JTB	30	95	1.2e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123839

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157045

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	T	C	1: 74,282,445	E169G	possibly damaging	Het
Acat2	G	A	17: 12,943,927	R377C	probably benign	Het
Adgrg6	A	G	10: 14,456,167	V398A	probably damaging	Het
BC025920	A	G	10: 81,609,301	H86R	probably damaging	Het
BC028528	T	C	3: 95,888,227	T88A	probably damaging	Het
Dhcr7	T	C	7: 143,843,311	V180A	probably damaging	Het
Fam187a	T	C	11: 102,886,189	V273A	probably damaging	Het
Hdgfl3	G	A	7: 81,900,353	R78W	possibly damaging	Het
Krt8	T	C	15: 101,998,004	T357A	probably benign	Het
Lkaaear1	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	2: 181,697,561		probably benign	Het
Ly6d	A	T	15: 74,762,450	V97D	probably benign	Het
Map3k13	T	C	16: 21,892,312	I115T	probably benign	Het
Muc2	G	A	7: 141,751,477	V173I	probably benign	Het
Nck2	T	C	1: 43,569,178	S327P	probably benign	Het
Ncoa7	T	C	10: 30,771,721	R20G	probably damaging	Het
Nlrp4f	G	A	13: 65,199,195	T83I	probably benign	Het
Nploc4	A	G	11: 120,383,330	S546P	probably damaging	Het
Olfr1444	A	G	19: 12,862,650	S292G	probably damaging	Het
Olfr396-ps1	A	G	11: 73,928,113	Y36C	probably damaging	Het
Olfr577	C	T	7: 102,973,713	R93Q	probably benign	Het
Olfr671	C	T	7: 104,975,968	V10I	probably benign	Het
Panx1	T	C	9: 15,008,011	E184G	probably benign	Het
Parp14	T	C	16: 35,834,677	Y1808C	probably damaging	Het
Plcb1	A	T	2: 134,786,593	S21C	probably benign	Het
Ppil6	A	G	10: 41,498,431	N103D	probably benign	Het
Pth1r	C	T	9: 110,727,251		probably null	Het
Rapgef4	A	T	2: 72,054,779		probably benign	Het
Rlf	A	G	4: 121,147,926	S1286P	probably damaging	Het
Rnf217	A	G	10: 31,534,826	V291A	possibly damaging	Het
Serpina3a	T	C	12: 104,119,637	M117T	probably benign	Het
St8sia4	T	C	1: 95,653,699	D106G	probably damaging	Het
Tjp2	A	G	19: 24,120,843	I485T	probably damaging	Het
Trdc	T	C	14: 54,144,235		probably benign	Het
Ttn	A	G	2: 76,710,660	L33994P	probably damaging	Het
Vmn2r42	T	A	7: 8,184,225	K799N	probably damaging	Het
Zfp42	G	A	8: 43,296,056	T136M	possibly damaging	Het
Znhit1	A	T	5: 136,982,633	S109T	probably benign	Het

Other mutations in Creb3l4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Creb3l4	APN	3	90241987	missense	possibly damaging	0.95
IGL01015:Creb3l4	APN	3	90242831	start codon destroyed	probably null
IGL01092:Creb3l4	APN	3	90237738	missense	probably damaging	1.00
IGL02172:Creb3l4	APN	3	90242775	missense	probably benign	0.21
IGL02291:Creb3l4	APN	3	90241983	missense	probably benign	0.03
R1344:Creb3l4	UTSW	3	90238738	missense	possibly damaging	0.73
R1418:Creb3l4	UTSW	3	90238738	missense	possibly damaging	0.73
R1836:Creb3l4	UTSW	3	90238903	missense	probably benign	0.26
R2154:Creb3l4	UTSW	3	90238485	missense	probably damaging	1.00
R2877:Creb3l4	UTSW	3	90242308	missense	probably damaging	0.99
R4923:Creb3l4	UTSW	3	90242214	missense	probably benign	0.00
R6024:Creb3l4	UTSW	3	90238699	missense	probably damaging	1.00
R7567:Creb3l4	UTSW	3	90242422	missense	probably benign	0.00
R8749:Creb3l4	UTSW	3	90237892	missense	probably benign
R8794:Creb3l4	UTSW	3	90237918	missense	probably benign	0.04
Z1088:Creb3l4	UTSW	3	90237751	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCCCTTTGACCTTACCACAAAG -3'
(R):5'- AGGATGAGCCACGAAACAATTCTC -3'

Sequencing Primer
(F):5'- TTGACCTTACCACAAAGAAGAAATG -3'
(R):5'- CAAGTAGGAGTTCTGGGCCAGTC -3'

Posted On

2018-07-23