Incidental Mutation 'R6683:Vmn2r42'
ID 527572
Institutional Source Beutler Lab
Gene Symbol Vmn2r42
Ensembl Gene ENSMUSG00000070844
Gene Name vomeronasal 2, receptor 42
Synonyms V2r4
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R6683 (G1)
Quality Score 92.0077
Status Not validated
Chromosome 7
Chromosomal Location 8183265-8200320 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8184225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 799 (K799N)
Ref Sequence ENSEMBL: ENSMUSP00000119761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086282] [ENSMUST00000142934] [ENSMUST00000146278]
AlphaFold O35192
Predicted Effect probably damaging
Transcript: ENSMUST00000086282
AA Change: K849N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083463
Gene: ENSMUSG00000070844
AA Change: K849N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136957
Predicted Effect probably benign
Transcript: ENSMUST00000142934
SMART Domains Protein: ENSMUSP00000123451
Gene: ENSMUSG00000070844

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 469 7.4e-34 PFAM
Pfam:NCD3G 512 563 4.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146278
AA Change: K799N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119761
Gene: ENSMUSG00000070844
AA Change: K799N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.9e-33 PFAM
Pfam:NCD3G 512 565 6.7e-17 PFAM
Pfam:7tm_3 548 784 2e-78 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Vmn2r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Vmn2r42 APN 7 8184313 missense probably damaging 0.99
IGL02793:Vmn2r42 APN 7 8194853 missense probably benign 0.00
IGL02875:Vmn2r42 APN 7 8194853 missense probably benign 0.00
R1743:Vmn2r42 UTSW 7 8184265 missense probably benign 0.06
R3943:Vmn2r42 UTSW 7 8194780 missense possibly damaging 0.93
R4117:Vmn2r42 UTSW 7 8194840 missense probably damaging 1.00
R4760:Vmn2r42 UTSW 7 8184277 missense probably damaging 1.00
R5233:Vmn2r42 UTSW 7 8194838 nonsense probably null
R6245:Vmn2r42 UTSW 7 8192734 missense probably damaging 1.00
R6709:Vmn2r42 UTSW 7 8192619 missense probably benign 0.09
R7396:Vmn2r42 UTSW 7 8192642 missense probably benign 0.00
R7450:Vmn2r42 UTSW 7 8184221 missense probably benign 0.00
R7583:Vmn2r42 UTSW 7 8194741 nonsense probably null
R7973:Vmn2r42 UTSW 7 8194873 missense probably benign 0.03
R8777:Vmn2r42 UTSW 7 8192693 missense probably benign 0.14
R8777-TAIL:Vmn2r42 UTSW 7 8192693 missense probably benign 0.14
R8900:Vmn2r42 UTSW 7 8194793 missense probably benign 0.15
R8972:Vmn2r42 UTSW 7 8184332 missense probably damaging 1.00
R9335:Vmn2r42 UTSW 7 8194759 missense probably damaging 0.99
R9453:Vmn2r42 UTSW 7 8184296 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCAAGATTTTATGGACACTGTACGG -3'
(R):5'- CCTGATGCATTCAATGAAGCC -3'

Sequencing Primer
(F):5'- TATGGACACTGTACGGAAGTTC -3'
(R):5'- GAAGCCAAGTTCTTGACCTTCAG -3'
Posted On 2018-07-23