Incidental Mutation 'R6683:Olfr577'
ID 527574
Institutional Source Beutler Lab
Gene Symbol Olfr577
Ensembl Gene ENSMUSG00000043354
Gene Name olfactory receptor 577
Synonyms MOR7-2, GA_x6K02T2PBJ9-5685322-5684384
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102971180-102975943 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102973713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 93 (R93Q)
Ref Sequence ENSEMBL: ENSMUSP00000150712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051505] [ENSMUST00000185326] [ENSMUST00000214080] [ENSMUST00000215237]
AlphaFold Q8VH11
Predicted Effect probably benign
Transcript: ENSMUST00000051505
AA Change: R93Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059586
Gene: ENSMUSG00000043354
AA Change: R93Q

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-140 PFAM
Pfam:7TM_GPCR_Srsx 38 310 1.2e-6 PFAM
Pfam:7tm_1 44 295 7.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185326
SMART Domains Protein: ENSMUSP00000142459
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 300 9.7e-12 PFAM
Pfam:7tm_1 41 291 1.8e-29 PFAM
Pfam:7tm_4 140 284 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214080
AA Change: R93Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215237
AA Change: R93Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Olfr577
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Olfr577 APN 7 102973744 missense possibly damaging 0.62
IGL03111:Olfr577 APN 7 102973531 missense probably damaging 1.00
R1529:Olfr577 UTSW 7 102973879 missense probably damaging 1.00
R1753:Olfr577 UTSW 7 102973056 missense probably benign
R3005:Olfr577 UTSW 7 102973258 missense possibly damaging 0.56
R4457:Olfr577 UTSW 7 102973527 missense probably damaging 1.00
R4675:Olfr577 UTSW 7 102973806 missense probably damaging 0.99
R4808:Olfr577 UTSW 7 102973911 missense probably damaging 0.99
R4891:Olfr577 UTSW 7 102973552 missense probably benign 0.12
R4917:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R4918:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R5328:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
R6375:Olfr577 UTSW 7 102973753 missense probably damaging 1.00
R6958:Olfr577 UTSW 7 102973884 missense possibly damaging 0.67
R7022:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
R7429:Olfr577 UTSW 7 102973762 missense probably damaging 1.00
R7430:Olfr577 UTSW 7 102973762 missense probably damaging 1.00
R7490:Olfr577 UTSW 7 102973810 missense probably damaging 1.00
R7808:Olfr577 UTSW 7 102973110 missense possibly damaging 0.56
R8169:Olfr577 UTSW 7 102973338 missense probably damaging 0.99
R8544:Olfr577 UTSW 7 102973731 missense probably damaging 1.00
R9027:Olfr577 UTSW 7 102973353 missense probably damaging 1.00
R9265:Olfr577 UTSW 7 102973905 nonsense probably null
X0027:Olfr577 UTSW 7 102973686 missense probably benign 0.05
Z1176:Olfr577 UTSW 7 102973309 missense not run
Z1177:Olfr577 UTSW 7 102973309 missense not run
Predicted Primers PCR Primer
(F):5'- ATGAGTGCAACACTACGGCC -3'
(R):5'- AGCACATGCATATCTGGATCTC -3'

Sequencing Primer
(F):5'- ACACTACGGCCCAGAGAGG -3'
(R):5'- ACATGCATATCTGGATCTCCCTTC -3'
Posted On 2018-07-23