Mutagenetix > Incidental Mutation

Incidental Mutation 'R6683:Muc2'

527576

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044802-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141305214 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 173 (V173I)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026590
AA Change: V173I

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: V173I

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: V612I

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	T	C	1: 74,321,604 (GRCm39)	E169G	possibly damaging	Het
Acat2	G	A	17: 13,162,814 (GRCm39)	R377C	probably benign	Het
Adgrg6	A	G	10: 14,331,911 (GRCm39)	V398A	probably damaging	Het
BC025920	A	G	10: 81,445,135 (GRCm39)	H86R	probably damaging	Het
BC028528	T	C	3: 95,795,539 (GRCm39)	T88A	probably damaging	Het
Creb3l4	T	A	3: 90,145,112 (GRCm39)	T347S	probably benign	Het
Dhcr7	T	C	7: 143,397,048 (GRCm39)	V180A	probably damaging	Het
Fam187a	T	C	11: 102,777,015 (GRCm39)	V273A	probably damaging	Het
Hdgfl3	G	A	7: 81,550,101 (GRCm39)	R78W	possibly damaging	Het
Krt8	T	C	15: 101,906,439 (GRCm39)	T357A	probably benign	Het
Lkaaear1	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	2: 181,339,354 (GRCm39)		probably benign	Het
Ly6d	A	T	15: 74,634,299 (GRCm39)	V97D	probably benign	Het
Map3k13	T	C	16: 21,711,062 (GRCm39)	I115T	probably benign	Het
Nck2	T	C	1: 43,608,338 (GRCm39)	S327P	probably benign	Het
Ncoa7	T	C	10: 30,647,717 (GRCm39)	R20G	probably damaging	Het
Nlrp4f	G	A	13: 65,347,009 (GRCm39)	T83I	probably benign	Het
Nploc4	A	G	11: 120,274,156 (GRCm39)	S546P	probably damaging	Het
Or1e1d-ps1	A	G	11: 73,818,939 (GRCm39)	Y36C	probably damaging	Het
Or51g2	C	T	7: 102,622,920 (GRCm39)	R93Q	probably benign	Het
Or52e8	C	T	7: 104,625,175 (GRCm39)	V10I	probably benign	Het
Or5b21	A	G	19: 12,840,014 (GRCm39)	S292G	probably damaging	Het
Panx1	T	C	9: 14,919,307 (GRCm39)	E184G	probably benign	Het
Parp14	T	C	16: 35,655,047 (GRCm39)	Y1808C	probably damaging	Het
Plcb1	A	T	2: 134,628,513 (GRCm39)	S21C	probably benign	Het
Ppil6	A	G	10: 41,374,427 (GRCm39)	N103D	probably benign	Het
Pth1r	C	T	9: 110,556,319 (GRCm39)		probably null	Het
Rapgef4	A	T	2: 71,885,123 (GRCm39)		probably benign	Het
Rlf	A	G	4: 121,005,123 (GRCm39)	S1286P	probably damaging	Het
Rnf217	A	G	10: 31,410,822 (GRCm39)	V291A	possibly damaging	Het
Serpina3a	T	C	12: 104,085,896 (GRCm39)	M117T	probably benign	Het
St8sia4	T	C	1: 95,581,424 (GRCm39)	D106G	probably damaging	Het
Tjp2	A	G	19: 24,098,207 (GRCm39)	I485T	probably damaging	Het
Trdc	T	C	14: 54,381,692 (GRCm39)		probably benign	Het
Ttn	A	G	2: 76,541,004 (GRCm39)	L33994P	probably damaging	Het
Vmn2r42	T	A	7: 8,187,224 (GRCm39)	K799N	probably damaging	Het
Zfp42	G	A	8: 43,749,093 (GRCm39)	T136M	possibly damaging	Het
Znhit1	A	T	5: 137,011,487 (GRCm39)	S109T	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- CCTGTCTGACCATATGGATAGCC -3'
(R):5'- CTCTTGGTCTGATCCAGCAG -3'

Sequencing Primer
(F):5'- ACCATATGGATAGCCTGGTGC -3'
(R):5'- TCTCCAGTAAGCAGAACCTGAG -3'

Posted On

2018-07-23