Incidental Mutation 'R6683:Zfp42'
ID 527578
Institutional Source Beutler Lab
Gene Symbol Zfp42
Ensembl Gene ENSMUSG00000051176
Gene Name zinc finger protein 42
Synonyms Zfp-42, Rex-1, Rex1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 43295063-43306980 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43296056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 136 (T136M)
Ref Sequence ENSEMBL: ENSMUSP00000147606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082120] [ENSMUST00000209356] [ENSMUST00000211248]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082120
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080765
Gene: ENSMUSG00000051176
AA Change: T136M

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
ZnF_C2H2 170 194 6.88e-4 SMART
ZnF_C2H2 199 221 2.2e-2 SMART
ZnF_C2H2 227 251 3.95e-4 SMART
ZnF_C2H2 257 281 1.67e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209356
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211248
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit premature age-related male germ cell loss, abnormal sperm morphology, and mild testicular atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Zfp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0325:Zfp42 UTSW 8 43295951 missense probably damaging 0.98
R0648:Zfp42 UTSW 8 43295978 missense probably benign
R1494:Zfp42 UTSW 8 43295601 missense possibly damaging 0.96
R3618:Zfp42 UTSW 8 43295901 missense possibly damaging 0.94
R4695:Zfp42 UTSW 8 43296131 missense probably damaging 0.99
R4877:Zfp42 UTSW 8 43295688 missense possibly damaging 0.94
R6684:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R6685:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R7264:Zfp42 UTSW 8 43296275 missense probably damaging 0.96
R9297:Zfp42 UTSW 8 43295735 missense possibly damaging 0.92
Z1088:Zfp42 UTSW 8 43295805 missense probably benign 0.37
Z1176:Zfp42 UTSW 8 43296240 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTCGAGCTCTCCGTGAAGG -3'
(R):5'- AGGTGAGTTTTCCGAACCC -3'

Sequencing Primer
(F):5'- AGCTCTCCGTGAAGGCTTTG -3'
(R):5'- TTTCCGAACCCATTCTGGAAGAGG -3'
Posted On 2018-07-23