Incidental Mutation 'R6683:Panx1'
ID 527579
Institutional Source Beutler Lab
Gene Symbol Panx1
Ensembl Gene ENSMUSG00000031934
Gene Name pannexin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 15002128-15045478 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15008011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 184 (E184G)
Ref Sequence ENSEMBL: ENSMUSP00000126405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]
AlphaFold Q9JIP4
Predicted Effect silent
Transcript: ENSMUST00000056755
SMART Domains Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

DomainStartEndE-ValueType
Pfam:Innexin 31 102 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164273
AA Change: E184G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934
AA Change: E184G

DomainStartEndE-ValueType
Pfam:Innexin 33 256 2.1e-16 PFAM
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166933
Predicted Effect probably benign
Transcript: ENSMUST00000169288
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Panx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Panx1 APN 9 15007844 missense probably damaging 0.97
IGL01364:Panx1 APN 9 15021465 missense probably damaging 1.00
IGL02831:Panx1 APN 9 15007648 missense probably damaging 1.00
IGL02861:Panx1 APN 9 15007805 missense probably benign
cathedral UTSW 9 15007633 missense possibly damaging 0.53
elephant UTSW 9 15010217 missense probably damaging 1.00
notre_dame UTSW 9 15010217 missense probably damaging 1.00
R0422:Panx1 UTSW 9 15007816 nonsense probably null
R0602:Panx1 UTSW 9 15010204 missense probably damaging 1.00
R1509:Panx1 UTSW 9 15010045 missense possibly damaging 0.53
R1681:Panx1 UTSW 9 15007783 missense probably benign 0.13
R1862:Panx1 UTSW 9 15007428 missense probably damaging 1.00
R1895:Panx1 UTSW 9 15007526 missense probably benign 0.13
R1937:Panx1 UTSW 9 15007684 missense possibly damaging 0.68
R1946:Panx1 UTSW 9 15007526 missense probably benign 0.13
R2447:Panx1 UTSW 9 15044889 missense probably damaging 0.99
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3733:Panx1 UTSW 9 15006171 unclassified probably benign
R3734:Panx1 UTSW 9 15006171 unclassified probably benign
R3958:Panx1 UTSW 9 15006171 unclassified probably benign
R3960:Panx1 UTSW 9 15006171 unclassified probably benign
R4744:Panx1 UTSW 9 15010298 intron probably benign
R4990:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R5272:Panx1 UTSW 9 15044856 critical splice donor site probably null
R5556:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R5935:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R6126:Panx1 UTSW 9 15007790 missense probably benign 0.38
R6743:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R6873:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R7944:Panx1 UTSW 9 15007829 missense probably damaging 1.00
R8061:Panx1 UTSW 9 15045001 missense possibly damaging 0.58
Z1177:Panx1 UTSW 9 15007814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCACAGAAACTCGTCC -3'
(R):5'- CTCACATTTAACCAAGCAGATTGTC -3'

Sequencing Primer
(F):5'- TGCACAGAAACTCGTCCGAGAG -3'
(R):5'- CACACTTGATGAGACTGG -3'
Posted On 2018-07-23