Incidental Mutation 'R6683:Rnf217'
ID 527583
Institutional Source Beutler Lab
Gene Symbol Rnf217
Ensembl Gene ENSMUSG00000063760
Gene Name ring finger protein 217
Synonyms Ibrdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 31493193-31609184 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31534826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000080650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081989]
AlphaFold D3YYI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000081989
AA Change: V291A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080650
Gene: ENSMUSG00000063760
AA Change: V291A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 39 59 N/A INTRINSIC
low complexity region 97 121 N/A INTRINSIC
low complexity region 147 191 N/A INTRINSIC
RING 236 280 2.01e-1 SMART
IBR 301 369 2.66e-16 SMART
IBR 376 447 3.19e-1 SMART
RING 396 425 4.87e0 SMART
transmembrane domain 479 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene is a member of the RING1-IBR-RING24 (RBR) ubiquitin protein ligase family, and it belongs to a subfamily of these proteins that contain a transmembrane domain. This protein can interact with the HAX1 anti-apoptotic protein via its C-terminal RING finger motif, which suggests a role in apoptosis signaling. It is thought that deregulation of this gene can be a mechanism in leukemogenesis. Mutations in the region encoding the protein GXXXG motif, which appears to be necessary for protein self-association, have been found in human cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Rnf217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Rnf217 APN 10 31503774 missense probably damaging 0.99
IGL01102:Rnf217 APN 10 31608503 missense probably damaging 0.97
IGL02160:Rnf217 APN 10 31505771 critical splice donor site probably null
R0582:Rnf217 UTSW 10 31608767 missense possibly damaging 0.88
R0825:Rnf217 UTSW 10 31517457 missense probably damaging 1.00
R1606:Rnf217 UTSW 10 31534811 missense possibly damaging 0.93
R3715:Rnf217 UTSW 10 31534732 nonsense probably null
R3809:Rnf217 UTSW 10 31503808 missense possibly damaging 0.52
R4533:Rnf217 UTSW 10 31608763 missense possibly damaging 0.73
R4606:Rnf217 UTSW 10 31517476 nonsense probably null
R4937:Rnf217 UTSW 10 31517524 missense probably benign
R6940:Rnf217 UTSW 10 31505977 splice site probably null
R7751:Rnf217 UTSW 10 31517419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGTCTGGAGAGCATACTTAC -3'
(R):5'- GAGAACGCTTTAACATCCTATAGATCC -3'

Sequencing Primer
(F):5'- GGAGAGCATACTTACTTTGTATCTGC -3'
(R):5'- CCTTAATAACCAGTGGTCTC -3'
Posted On 2018-07-23