Incidental Mutation 'R6683:Nploc4'
ID 527588
Institutional Source Beutler Lab
Gene Symbol Nploc4
Ensembl Gene ENSMUSG00000039703
Gene Name NPL4 homolog, ubiquitin recognition factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 120380370-120437708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120383330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 546 (S546P)
Ref Sequence ENSEMBL: ENSMUSP00000035851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026448] [ENSMUST00000044271] [ENSMUST00000103017]
AlphaFold P60670
PDB Structure Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000026448
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044271
AA Change: S546P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035851
Gene: ENSMUSG00000039703
AA Change: S546P

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 1.1e-36 PFAM
Pfam:zf-NPL4 105 245 2.1e-64 PFAM
Pfam:NPL4 248 557 4.8e-129 PFAM
ZnF_RBZ 582 606 8.4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103017
AA Change: S514P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099306
Gene: ENSMUSG00000039703
AA Change: S514P

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 7e-38 PFAM
Pfam:zf-NPL4 104 246 1.1e-61 PFAM
Pfam:NPL4 248 455 1.8e-87 PFAM
Pfam:NPL4 451 525 3e-15 PFAM
ZnF_RBZ 550 574 8.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154826
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Nploc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Nploc4 APN 11 120389372 missense probably benign 0.06
IGL03373:Nploc4 APN 11 120409629 nonsense probably null
P0041:Nploc4 UTSW 11 120418331 missense probably damaging 1.00
R0200:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R0608:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R1401:Nploc4 UTSW 11 120383289 splice site probably benign
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1722:Nploc4 UTSW 11 120382569 missense probably benign 0.02
R1919:Nploc4 UTSW 11 120404229 missense probably damaging 1.00
R2436:Nploc4 UTSW 11 120418317 missense possibly damaging 0.79
R4603:Nploc4 UTSW 11 120385787 missense probably benign 0.00
R4771:Nploc4 UTSW 11 120421434 missense possibly damaging 0.47
R5179:Nploc4 UTSW 11 120408856 missense probably benign 0.02
R5361:Nploc4 UTSW 11 120384563 missense probably damaging 1.00
R5414:Nploc4 UTSW 11 120413643 missense probably damaging 0.99
R5567:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R5570:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R6259:Nploc4 UTSW 11 120385865 missense probably benign 0.01
R6547:Nploc4 UTSW 11 120428522 critical splice donor site probably null
R7134:Nploc4 UTSW 11 120385788 missense probably benign 0.02
R7256:Nploc4 UTSW 11 120428550 missense probably benign
R7284:Nploc4 UTSW 11 120416370 missense possibly damaging 0.89
R7386:Nploc4 UTSW 11 120408881 missense probably benign 0.17
R8130:Nploc4 UTSW 11 120389414 missense possibly damaging 0.80
R8835:Nploc4 UTSW 11 120418296 missense possibly damaging 0.95
R9031:Nploc4 UTSW 11 120428542 missense probably damaging 1.00
R9075:Nploc4 UTSW 11 120413700 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAAGCAGCCACCCATGTCTG -3'
(R):5'- TTTGCAGTGACAGCTTCTGAG -3'

Sequencing Primer
(F):5'- ATGTCTGTCCCTTTGCCCAAG -3'
(R):5'- TATCAGCCTGCTGCTAGA -3'
Posted On 2018-07-23