Incidental Mutation 'R6683:Serpina3a'
ID527589
Institutional Source Beutler Lab
Gene Symbol Serpina3a
Ensembl Gene ENSMUSG00000041536
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6683 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location104112724-104121896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104119637 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 117 (M117T)
Ref Sequence ENSEMBL: ENSMUSP00000105591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021496] [ENSMUST00000109965] [ENSMUST00000185595]
Predicted Effect probably benign
Transcript: ENSMUST00000021496
AA Change: M307T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021496
Gene: ENSMUSG00000041536
AA Change: M307T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109965
AA Change: M117T

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105591
Gene: ENSMUSG00000041536
AA Change: M117T

DomainStartEndE-ValueType
SERPIN 4 229 5.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185595
AA Change: M307T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140024
Gene: ENSMUSG00000041536
AA Change: M307T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Serpina3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Serpina3a APN 12 104121499 missense probably benign 0.05
IGL02003:Serpina3a APN 12 104116000 missense probably benign 0.02
IGL02379:Serpina3a APN 12 104118660 missense probably benign 0.00
IGL02547:Serpina3a APN 12 104116543 missense probably damaging 0.98
IGL02593:Serpina3a APN 12 104118432 missense probably benign 0.01
IGL02730:Serpina3a APN 12 104119663 missense probably damaging 1.00
IGL02953:Serpina3a APN 12 104116489 missense probably benign 0.00
IGL03197:Serpina3a APN 12 104116241 missense probably damaging 1.00
R1184:Serpina3a UTSW 12 104116528 nonsense probably null
R1635:Serpina3a UTSW 12 104116478 missense probably damaging 1.00
R1688:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R1804:Serpina3a UTSW 12 104118416 splice site probably benign
R1867:Serpina3a UTSW 12 104118627 missense probably benign 0.01
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R2110:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2111:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2305:Serpina3a UTSW 12 104116528 missense probably benign 0.05
R2326:Serpina3a UTSW 12 104116499 missense probably benign 0.01
R2405:Serpina3a UTSW 12 104121318 missense possibly damaging 0.50
R4008:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4010:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4011:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4079:Serpina3a UTSW 12 104119675 nonsense probably null
R4091:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4092:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4210:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R5064:Serpina3a UTSW 12 104116189 missense probably benign 0.01
R6242:Serpina3a UTSW 12 104116001 missense probably benign 0.10
R6337:Serpina3a UTSW 12 104112878 missense probably benign 0.36
R6395:Serpina3a UTSW 12 104116451 missense probably damaging 0.99
R6994:Serpina3a UTSW 12 104112830 splice site probably null
R7117:Serpina3a UTSW 12 104116177 missense possibly damaging 0.95
R8104:Serpina3a UTSW 12 104112851 start gained probably benign
R8131:Serpina3a UTSW 12 104116208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGCCTGTCCACTGTAAGC -3'
(R):5'- TACATTCAGGACCCAAAATGACTG -3'

Sequencing Primer
(F):5'- GTCCACTGTAAGCACTCTCAG -3'
(R):5'- AATGACTGACCCTGTGTTTATTGTC -3'
Posted On2018-07-23