Incidental Mutation 'R6683:Ly6d'
ID 527592
Institutional Source Beutler Lab
Gene Symbol Ly6d
Ensembl Gene ENSMUSG00000034634
Gene Name lymphocyte antigen 6 complex, locus D
Synonyms Ly-61, Ly61, Thb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 74762056-74763620 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74762450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 97 (V97D)
Ref Sequence ENSEMBL: ENSMUSP00000047419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040404]
AlphaFold P35459
Predicted Effect probably benign
Transcript: ENSMUST00000040404
AA Change: V97D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047419
Gene: ENSMUSG00000034634
AA Change: V97D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 21 106 4.91e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Ly6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1832:Ly6d UTSW 15 74762766 missense probably damaging 0.99
R5870:Ly6d UTSW 15 74763532 missense possibly damaging 0.63
R6894:Ly6d UTSW 15 74762805 missense possibly damaging 0.91
R7198:Ly6d UTSW 15 74762535 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCATCATGGCTAAAGCATGGG -3'
(R):5'- AGGCTTGATCCTGGGAATGG -3'

Sequencing Primer
(F):5'- GCTAAAGCATGGGCCGTG -3'
(R):5'- GTACACTAAGTCAGGCCTGATGC -3'
Posted On 2018-07-23