Incidental Mutation 'R6683:Parp14'
ID 527595
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Name poly (ADP-ribose) polymerase family, member 14
Synonyms collaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 35832874-35871544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35834677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1808 (Y1808C)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
AlphaFold Q2EMV9
PDB Structure Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000042665
AA Change: Y1808C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: Y1808C

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231601
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Acat2 G A 17: 12,943,927 R377C probably benign Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
PIT4585001:Parp14 UTSW 16 35858605 missense probably benign 0.03
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R7525:Parp14 UTSW 16 35857491 missense probably benign 0.00
R8011:Parp14 UTSW 16 35856634 missense probably benign 0.00
R8192:Parp14 UTSW 16 35871214 missense probably benign 0.01
R8367:Parp14 UTSW 16 35857754 missense probably benign 0.36
R8526:Parp14 UTSW 16 35840937 missense possibly damaging 0.87
R8751:Parp14 UTSW 16 35856811 missense probably benign 0.32
R8962:Parp14 UTSW 16 35856817 missense probably damaging 1.00
R9231:Parp14 UTSW 16 35841213 missense probably damaging 0.98
R9363:Parp14 UTSW 16 35858216 missense possibly damaging 0.90
R9366:Parp14 UTSW 16 35839260 critical splice donor site probably null
R9379:Parp14 UTSW 16 35860483 missense probably benign 0.08
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35845338 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35871203 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCGATTGGCTCTCAAGTAGATTC -3'
(R):5'- AAAGCTTCCTATTCTGCCTGTG -3'

Sequencing Primer
(F):5'- CATTTTCACTGTGGAGGAAACACAC -3'
(R):5'- TGCCTGTGACACATATTCCAGAC -3'
Posted On 2018-07-23