Incidental Mutation 'R6683:Acat2'
ID 527596
Institutional Source Beutler Lab
Gene Symbol Acat2
Ensembl Gene ENSMUSG00000023832
Gene Name acetyl-Coenzyme A acetyltransferase 2
Synonyms Tcp-1x, Tcp1-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12942890-12960747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12943927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 377 (R377C)
Ref Sequence ENSEMBL: ENSMUSP00000007005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007005] [ENSMUST00000043923] [ENSMUST00000159697] [ENSMUST00000160378]
AlphaFold Q8CAY6
Predicted Effect probably benign
Transcript: ENSMUST00000007005
AA Change: R377C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007005
Gene: ENSMUSG00000023832
AA Change: R377C

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 8e-99 PFAM
Pfam:Thiolase_C 274 396 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159358
Predicted Effect probably benign
Transcript: ENSMUST00000159697
AA Change: R345C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125066
Gene: ENSMUSG00000023832
AA Change: R345C

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 235 3.9e-91 PFAM
Pfam:Thiolase_C 242 364 2.4e-53 PFAM
Pfam:ACP_syn_III_C 273 364 9.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp T C 1: 74,282,445 E169G possibly damaging Het
Adgrg6 A G 10: 14,456,167 V398A probably damaging Het
BC025920 A G 10: 81,609,301 H86R probably damaging Het
BC028528 T C 3: 95,888,227 T88A probably damaging Het
Creb3l4 T A 3: 90,237,805 T347S probably benign Het
Dhcr7 T C 7: 143,843,311 V180A probably damaging Het
Fam187a T C 11: 102,886,189 V273A probably damaging Het
Hdgfl3 G A 7: 81,900,353 R78W possibly damaging Het
Krt8 T C 15: 101,998,004 T357A probably benign Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Ly6d A T 15: 74,762,450 V97D probably benign Het
Map3k13 T C 16: 21,892,312 I115T probably benign Het
Muc2 G A 7: 141,751,477 V173I probably benign Het
Nck2 T C 1: 43,569,178 S327P probably benign Het
Ncoa7 T C 10: 30,771,721 R20G probably damaging Het
Nlrp4f G A 13: 65,199,195 T83I probably benign Het
Nploc4 A G 11: 120,383,330 S546P probably damaging Het
Olfr1444 A G 19: 12,862,650 S292G probably damaging Het
Olfr396-ps1 A G 11: 73,928,113 Y36C probably damaging Het
Olfr577 C T 7: 102,973,713 R93Q probably benign Het
Olfr671 C T 7: 104,975,968 V10I probably benign Het
Panx1 T C 9: 15,008,011 E184G probably benign Het
Parp14 T C 16: 35,834,677 Y1808C probably damaging Het
Plcb1 A T 2: 134,786,593 S21C probably benign Het
Ppil6 A G 10: 41,498,431 N103D probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Rapgef4 A T 2: 72,054,779 probably benign Het
Rlf A G 4: 121,147,926 S1286P probably damaging Het
Rnf217 A G 10: 31,534,826 V291A possibly damaging Het
Serpina3a T C 12: 104,119,637 M117T probably benign Het
St8sia4 T C 1: 95,653,699 D106G probably damaging Het
Tjp2 A G 19: 24,120,843 I485T probably damaging Het
Trdc T C 14: 54,144,235 probably benign Het
Ttn A G 2: 76,710,660 L33994P probably damaging Het
Vmn2r42 T A 7: 8,184,225 K799N probably damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Acat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Acat2 APN 17 12944025 missense probably benign 0.00
R0243:Acat2 UTSW 17 12944021 missense probably benign
R4153:Acat2 UTSW 17 12952266 missense possibly damaging 0.88
R4224:Acat2 UTSW 17 12962885 unclassified probably benign
R4332:Acat2 UTSW 17 12962895 unclassified probably benign
R6219:Acat2 UTSW 17 12960717 unclassified probably benign
R6605:Acat2 UTSW 17 12943887 missense probably benign 0.07
R7313:Acat2 UTSW 17 12960006 missense probably benign 0.18
R7566:Acat2 UTSW 17 12947459 missense probably damaging 1.00
R8294:Acat2 UTSW 17 12956356 missense probably benign 0.03
R9098:Acat2 UTSW 17 12960092 start gained probably benign
R9341:Acat2 UTSW 17 12948651 missense probably damaging 0.99
R9343:Acat2 UTSW 17 12948651 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTGGGTGTCTCACATTAAAG -3'
(R):5'- TCGAAAGGATGGTTTGCTAGC -3'

Sequencing Primer
(F):5'- GGGTGTCTCACATTAAAGTACAGC -3'
(R):5'- TTGCTAGCATAACACTGCGG -3'
Posted On 2018-07-23