Incidental Mutation 'R6684:Lcn3'
ID527600
Institutional Source Beutler Lab
Gene Symbol Lcn3
Ensembl Gene ENSMUSG00000026936
Gene Namelipocalin 3
SynonymsVnsp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6684 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25765569-25768099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25766158 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 75 (H75L)
Ref Sequence ENSEMBL: ENSMUSP00000028304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028304]
Predicted Effect probably benign
Transcript: ENSMUST00000028304
AA Change: H75L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028304
Gene: ENSMUSG00000026936
AA Change: H75L

DomainStartEndE-ValueType
Pfam:Lipocalin 37 171 2.5e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 94% (33/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,569,139 R322W probably damaging Het
Capns1 C A 7: 30,193,899 G63V probably damaging Het
Carmil1 G A 13: 24,022,542 T5M unknown Het
Cr2 T A 1: 195,171,021 K70* probably null Het
Dapk1 T A 13: 60,760,894 I1107N probably damaging Het
Ehd4 A G 2: 120,154,334 F48L probably damaging Het
Fam221a G T 6: 49,372,608 E36* probably null Het
Fam81b G A 13: 76,202,038 Q423* probably null Het
Galnt7 C T 8: 57,538,109 V456I probably benign Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Hrc A G 7: 45,336,532 H369R possibly damaging Het
Impg2 T G 16: 56,259,929 S590A probably benign Het
Lims1 T A 10: 58,399,013 probably null Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Olfr507 A G 7: 108,621,934 T41A probably damaging Het
Orai3 A G 7: 127,773,720 N131S probably damaging Het
Pcdhga7 T C 18: 37,716,050 L370P probably damaging Het
Phtf2 A G 5: 20,812,939 probably benign Het
Plcg2 T C 8: 117,596,332 Y709H probably damaging Het
Pmfbp1 T C 8: 109,535,830 S719P probably benign Het
Polr3g A T 13: 81,699,531 probably null Het
Ppp4r1 G A 17: 65,824,342 A360T probably benign Het
Pramel6 T C 2: 87,509,404 W171R probably damaging Het
Rad54b T C 4: 11,583,689 probably benign Het
Rasl10a G A 11: 5,058,396 E31K possibly damaging Het
Ryr3 T C 2: 112,753,088 R2813G probably damaging Het
Tmem71 A G 15: 66,541,690 S178P possibly damaging Het
Trim58 A G 11: 58,651,620 T469A probably benign Het
Vash1 A G 12: 86,688,909 T190A probably damaging Het
Ythdc2 T C 18: 44,873,069 S1210P possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Zfp595 T C 13: 67,320,277 Y72C probably damaging Het
Other mutations in Lcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Lcn3 APN 2 25765624 missense probably benign 0.27
IGL02139:Lcn3 APN 2 25766634 missense possibly damaging 0.66
IGL02221:Lcn3 APN 2 25766160 missense probably benign 0.01
IGL02665:Lcn3 APN 2 25766404 missense possibly damaging 0.66
IGL03049:Lcn3 APN 2 25765574 start codon destroyed probably null 0.02
R0552:Lcn3 UTSW 2 25766409 critical splice donor site probably null
R3522:Lcn3 UTSW 2 25766121 missense possibly damaging 0.56
R4227:Lcn3 UTSW 2 25766111 missense probably benign 0.00
R6937:Lcn3 UTSW 2 25767811 nonsense probably null
R7010:Lcn3 UTSW 2 25766056 missense probably damaging 0.99
R7487:Lcn3 UTSW 2 25766162 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCGATCATGTGAGCTTTCTATG -3'
(R):5'- AGAAACAGTTTTGCAGTGGCC -3'

Sequencing Primer
(F):5'- TAGCTGGAGGGTAAATATTCCAC -3'
(R):5'- GCAGTGGCCCTCTTAAATCTGG -3'
Posted On2018-07-23