Incidental Mutation 'R6684:Galnt7'
ID527617
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Namepolypeptide N-acetylgalactosaminyltransferase 7
SynonymsppGaNTase-T7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6684 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location57523828-57653032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57538109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 456 (V456I)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
Predicted Effect probably benign
Transcript: ENSMUST00000034021
AA Change: V456I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: V456I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110316
AA Change: V456I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: V456I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 94% (33/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,569,139 R322W probably damaging Het
Capns1 C A 7: 30,193,899 G63V probably damaging Het
Carmil1 G A 13: 24,022,542 T5M unknown Het
Cr2 T A 1: 195,171,021 K70* probably null Het
Dapk1 T A 13: 60,760,894 I1107N probably damaging Het
Ehd4 A G 2: 120,154,334 F48L probably damaging Het
Fam221a G T 6: 49,372,608 E36* probably null Het
Fam81b G A 13: 76,202,038 Q423* probably null Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Hrc A G 7: 45,336,532 H369R possibly damaging Het
Impg2 T G 16: 56,259,929 S590A probably benign Het
Lcn3 A T 2: 25,766,158 H75L probably benign Het
Lims1 T A 10: 58,399,013 probably null Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Olfr507 A G 7: 108,621,934 T41A probably damaging Het
Orai3 A G 7: 127,773,720 N131S probably damaging Het
Pcdhga7 T C 18: 37,716,050 L370P probably damaging Het
Phtf2 A G 5: 20,812,939 probably benign Het
Plcg2 T C 8: 117,596,332 Y709H probably damaging Het
Pmfbp1 T C 8: 109,535,830 S719P probably benign Het
Polr3g A T 13: 81,699,531 probably null Het
Ppp4r1 G A 17: 65,824,342 A360T probably benign Het
Pramel6 T C 2: 87,509,404 W171R probably damaging Het
Rad54b T C 4: 11,583,689 probably benign Het
Rasl10a G A 11: 5,058,396 E31K possibly damaging Het
Ryr3 T C 2: 112,753,088 R2813G probably damaging Het
Tmem71 A G 15: 66,541,690 S178P possibly damaging Het
Trim58 A G 11: 58,651,620 T469A probably benign Het
Vash1 A G 12: 86,688,909 T190A probably damaging Het
Ythdc2 T C 18: 44,873,069 S1210P possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Zfp595 T C 13: 67,320,277 Y72C probably damaging Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0400:Galnt7 UTSW 8 57583989 missense probably damaging 0.99
R0553:Galnt7 UTSW 8 57552430 splice site probably benign
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5177:Galnt7 UTSW 8 57584027 missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6122:Galnt7 UTSW 8 57526166 missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6752:Galnt7 UTSW 8 57652951 missense probably damaging 1.00
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTAGCATGCTAGGTAGTCTATAAAC -3'
(R):5'- GCTAAGAGTAACTCACTGCTTACC -3'

Sequencing Primer
(F):5'- CCAGTTCACAGTGTATGTGT -3'
(R):5'- GCTTAGAATTCAATGTGGACATTAGG -3'
Posted On2018-07-23