Incidental Mutation 'R6684:Rasl10a'
ID527621
Institutional Source Beutler Lab
Gene Symbol Rasl10a
Ensembl Gene ENSMUSG00000034209
Gene NameRAS-like, family 10, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6684 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5058128-5060385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5058396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 31 (E31K)
Ref Sequence ENSEMBL: ENSMUSP00000048453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895]
Predicted Effect probably benign
Transcript: ENSMUST00000037146
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000037218
AA Change: E31K

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209
AA Change: E31K

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056649
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109895
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 94% (33/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,569,139 R322W probably damaging Het
Capns1 C A 7: 30,193,899 G63V probably damaging Het
Carmil1 G A 13: 24,022,542 T5M unknown Het
Cr2 T A 1: 195,171,021 K70* probably null Het
Dapk1 T A 13: 60,760,894 I1107N probably damaging Het
Ehd4 A G 2: 120,154,334 F48L probably damaging Het
Fam221a G T 6: 49,372,608 E36* probably null Het
Fam81b G A 13: 76,202,038 Q423* probably null Het
Galnt7 C T 8: 57,538,109 V456I probably benign Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Hrc A G 7: 45,336,532 H369R possibly damaging Het
Impg2 T G 16: 56,259,929 S590A probably benign Het
Lcn3 A T 2: 25,766,158 H75L probably benign Het
Lims1 T A 10: 58,399,013 probably null Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Olfr507 A G 7: 108,621,934 T41A probably damaging Het
Orai3 A G 7: 127,773,720 N131S probably damaging Het
Pcdhga7 T C 18: 37,716,050 L370P probably damaging Het
Phtf2 A G 5: 20,812,939 probably benign Het
Plcg2 T C 8: 117,596,332 Y709H probably damaging Het
Pmfbp1 T C 8: 109,535,830 S719P probably benign Het
Polr3g A T 13: 81,699,531 probably null Het
Ppp4r1 G A 17: 65,824,342 A360T probably benign Het
Pramel6 T C 2: 87,509,404 W171R probably damaging Het
Rad54b T C 4: 11,583,689 probably benign Het
Ryr3 T C 2: 112,753,088 R2813G probably damaging Het
Tmem71 A G 15: 66,541,690 S178P possibly damaging Het
Trim58 A G 11: 58,651,620 T469A probably benign Het
Vash1 A G 12: 86,688,909 T190A probably damaging Het
Ythdc2 T C 18: 44,873,069 S1210P possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Zfp595 T C 13: 67,320,277 Y72C probably damaging Het
Other mutations in Rasl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02233:Rasl10a APN 11 5058333 missense probably damaging 0.99
IGL03149:Rasl10a APN 11 5058429 missense possibly damaging 0.80
R1630:Rasl10a UTSW 11 5059542 missense probably damaging 0.99
R1678:Rasl10a UTSW 11 5059815 missense possibly damaging 0.61
R1925:Rasl10a UTSW 11 5059473 missense possibly damaging 0.84
R2086:Rasl10a UTSW 11 5059431 critical splice acceptor site probably null
R3792:Rasl10a UTSW 11 5059461 missense probably damaging 0.99
R4482:Rasl10a UTSW 11 5058429 missense probably damaging 1.00
R4719:Rasl10a UTSW 11 5058517 missense probably benign 0.03
R5743:Rasl10a UTSW 11 5059519 missense probably benign 0.02
R6168:Rasl10a UTSW 11 5058442 missense possibly damaging 0.76
R6530:Rasl10a UTSW 11 5058367 missense probably damaging 1.00
R8049:Rasl10a UTSW 11 5059823 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTTGAAACGGTTGAGGGAAGC -3'
(R):5'- CTGGATCAGTACACATGGGC -3'

Sequencing Primer
(F):5'- GCTTTAACAAGGCGACCCG -3'
(R):5'- TCAAGACTTCTGGGGCTT -3'
Posted On2018-07-23