Incidental Mutation 'R6685:Wisp2'
ID 527638
Institutional Source Beutler Lab
Gene Symbol Wisp2
Ensembl Gene ENSMUSG00000027656
Gene Name WNT1 inducible signaling pathway protein 2
Synonyms rCop1, Crgr4, CCN5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 163820861-163833146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 163828948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029188
AA Change: D125G

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: D125G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138730
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Wisp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Wisp2 APN 2 163829022 missense probably damaging 1.00
BB002:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
BB012:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R0336:Wisp2 UTSW 2 163832322 missense probably damaging 0.98
R0600:Wisp2 UTSW 2 163825313 missense probably damaging 1.00
R1241:Wisp2 UTSW 2 163829077 missense unknown
R1779:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R2921:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R2923:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R4049:Wisp2 UTSW 2 163828984 missense probably damaging 1.00
R4344:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R5409:Wisp2 UTSW 2 163825238 missense probably damaging 1.00
R5529:Wisp2 UTSW 2 163825359 critical splice donor site probably null
R5663:Wisp2 UTSW 2 163825253 missense probably damaging 1.00
R6401:Wisp2 UTSW 2 163829026 missense probably benign 0.45
R7242:Wisp2 UTSW 2 163828852 missense probably benign 0.27
R7925:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R8066:Wisp2 UTSW 2 163828942 missense probably damaging 1.00
R8701:Wisp2 UTSW 2 163828866 missense probably damaging 1.00
R8962:Wisp2 UTSW 2 163825240 nonsense probably null
R9215:Wisp2 UTSW 2 163829046 missense probably damaging 1.00
R9656:Wisp2 UTSW 2 163829065 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCTGTCTTGCTTAAGAGGGAG -3'
(R):5'- TAGGAGCTGCTGCAATGGAG -3'

Sequencing Primer
(F):5'- CTTGCTTAAGAGGGAGGTGGCC -3'
(R):5'- TGCTGCAATGGAGACCCTG -3'
Posted On 2018-07-23