Incidental Mutation 'R6685:Poteg'
ID527651
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6685 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27447905 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 30 (F30I)
Ref Sequence ENSEMBL: ENSMUSP00000080069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081321
AA Change: F30I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: F30I

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209669
Predicted Effect possibly damaging
Transcript: ENSMUST00000210427
AA Change: F26I

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211657
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7604:Poteg UTSW 8 27458655 intron probably null
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Z1176:Poteg UTSW 8 27447954 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGAGGTTTAAGCCCTGAGGTCC -3'
(R):5'- AGGAAGTAAACCGTTGCCCTC -3'

Sequencing Primer
(F):5'- CCTGAGGTCCTCTGTGCAAATG -3'
(R):5'- GTAAACCGTTGCCCTCCCTCC -3'
Posted On2018-07-23