Incidental Mutation 'R6685:Sh3rf3'
ID 527653
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene Name SH3 domain containing ring finger 3
Synonyms Sh3md4, 4831416G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R6685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 58813359-59138916 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59086841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 580 (L580F)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153031]
AlphaFold Q8C120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152924
Predicted Effect possibly damaging
Transcript: ENSMUST00000153031
AA Change: L580F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: L580F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 59049356 missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 59049530 missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 59135828 missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 59086740 missense probably benign 0.02
exasperated UTSW 10 59086824 missense probably benign 0.06
strained UTSW 10 59007103 missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58984075 missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 59007082 missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 59131077 missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 59086667 nonsense probably null
R1869:Sh3rf3 UTSW 10 59083513 missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 59104167 splice site probably benign
R1968:Sh3rf3 UTSW 10 58813987 missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 59007073 missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 59086863 missense possibly damaging 0.83
R3769:Sh3rf3 UTSW 10 58984191 missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 59083533 missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 59083576 missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58813704 missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58814083 missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 59083519 missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58813723 missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 59086824 missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 59131190 missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58813947 missense probably benign
R5716:Sh3rf3 UTSW 10 59131283 missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 59104382 missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58984153 missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 59049448 missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 59130986 missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 59007076 missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58984144 missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58983969 missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 59083467 missense probably damaging 1.00
R7292:Sh3rf3 UTSW 10 59071973 missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 59086815 missense probably benign 0.01
R7941:Sh3rf3 UTSW 10 59007061 missense probably damaging 0.99
R7959:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R8140:Sh3rf3 UTSW 10 59049355 missense possibly damaging 0.88
R8142:Sh3rf3 UTSW 10 59049383 nonsense probably null
R8241:Sh3rf3 UTSW 10 59104420 missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 59083585 missense probably damaging 1.00
R8725:Sh3rf3 UTSW 10 59104170 critical splice acceptor site probably null
R8727:Sh3rf3 UTSW 10 59104170 critical splice acceptor site probably null
R9341:Sh3rf3 UTSW 10 59130980 missense probably damaging 0.99
R9343:Sh3rf3 UTSW 10 59130980 missense probably damaging 0.99
RF020:Sh3rf3 UTSW 10 58813768 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCACTAGAGTTCCTGGAGG -3'
(R):5'- AGATTCCAGGTTACGCGAAG -3'

Sequencing Primer
(F):5'- CTAGAGTTCCTGGAGGAGGGG -3'
(R):5'- TGACTTCCCCGACATGCTGG -3'
Posted On 2018-07-23