Mutagenetix > Incidental Mutation

Incidental Mutation 'R6685:Casc3'

527656

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

044804-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R6685 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98822530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 257 (K257E)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

AlphaFold

Q8K3W3

Predicted Effect

probably damaging
Transcript: ENSMUST00000017384
AA Change: K257E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: K257E

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147065

Predicted Effect

probably damaging
Transcript: ENSMUST00000169695
AA Change: K257E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: K257E

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox1	G	T	11: 116,180,348	Y203*	probably null	Het
Adcy5	A	G	16: 35,279,216	N712S	possibly damaging	Het
Adgrb3	G	A	1: 25,111,736	Q1139*	probably null	Het
Cttnbp2nl	G	T	3: 105,005,498	Q357K	probably benign	Het
Dcst1	A	C	3: 89,356,873	V345G	possibly damaging	Het
Dsg3	G	A	18: 20,520,615		probably null	Het
Ehbp1	A	G	11: 22,146,641	C308R	probably benign	Het
Etaa1	G	T	11: 17,953,582	D71E	probably benign	Het
Flg	T	C	3: 93,279,409	V56A	possibly damaging	Het
Gpr162	A	G	6: 124,861,531	L52P	probably damaging	Het
Inhbb	A	G	1: 119,417,605	L318P	probably damaging	Het
Lkaaear1	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	2: 181,697,561		probably benign	Het
Mcm8	G	A	2: 132,842,650	R728Q	probably damaging	Het
Metap1	A	T	3: 138,478,834	F126I	possibly damaging	Het
Olfr575	T	C	7: 102,955,681		probably null	Het
Peg10	T	A	6: 4,754,738	V173E	probably damaging	Het
Poteg	T	A	8: 27,447,905	F30I	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Sh3rf3	C	T	10: 59,086,841	L580F	possibly damaging	Het
Slc26a7	C	A	4: 14,593,819	V99F	probably damaging	Het
Slc26a7	A	T	4: 14,593,820	H98Q	probably damaging	Het
Slc9a2	A	T	1: 40,718,909	I203F	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Txnrd3	G	A	6: 89,669,915	V347I	possibly damaging	Het
Wisp2	A	G	2: 163,828,948	D125G	possibly damaging	Het
Zfp42	G	A	8: 43,296,056	T136M	possibly damaging	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8491:Casc3	UTSW	11	98823151	missense	probably benign	0.27
R8516:Casc3	UTSW	11	98822781	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCTTGGTTTGGTCCAGAC -3'
(R):5'- TCTCTTTGTGGGGAACTTCCAAATC -3'

Sequencing Primer
(F):5'- TCCAGACCCAAGGGACG -3'
(R):5'- TGTGGGGAACTTCCAAATCTGAAAC -3'

Posted On

2018-07-23